[BioRuby] Melting Temperature

[Rob Syme]

Hi Pjotr

I was looking as well. The only repo is https://github.com/shevegen/bioroebe,
but it is empty :(

-r

On Thu, Oct 9, 2014 at 11:04 AM, Pjotr Prins <pjotr.public14 at thebird.nl>
wrote:

> Github repository? Would be nice to add to biogems.info.
>
> Pj.
>
> On Thu, Oct 09, 2014 at 10:35:34AM -0400, Rob Syme wrote:
> > Hi David
> >
> > The 'bioroebe' gem includes Tm calculation.
> >
> >     $ gem install bioroebe
> >     $ irb
> >
> >     > require 'bioroebe/calculate_melting_temperature'
> >     > seq = 'ATGCTGACGTATGCGATCGTA'
> >     > tm = CalculateMeltingTemperature.new
> >     > tm.set_input(seq)
> >     > tm.calculate_tm
> >     # ==> 65.32166985617363
> >
> > You can set oligo nucleotide concentration, Na+ conc and
> > formamide_concentration.
> >
> > The method isn't too complicated
> > <
> http://rubydoc.info/gems/bioroebe/0.0.44/CalculateMeltingTemperature:calculate_tm
> >
> >
> > Rob Syme
> >
> > On Thu, Oct 9, 2014 at 6:10 AM, McCreavy David <
> David.McCreavy at lhch.nhs.uk>
> > wrote:
> >
> > > Hi Guys,
> > >
> > > Where in the API will I find methods for calculating Tm?
> > >
> > > Kind Regards, David
> > >
> > >
> > >
> > >
> > >
> > >
> ----------------------------------------------------------------------------------------------------------------
> > >
> > > This e-mail and any attachments may contain confidential and / or
> > > proprietary Trust information, some or all of which may be legally
> > > privileged, and may be subject to public disclosure under the NHS Code
> of
> > > Openness or the Freedom of Information Act 2000.
> > >
> > > The information held herein should only be used for its initial
> intended
> > > purpose(s).  It is for the exclusive use of the intended recipient(s)
> only
> > > and any unauthorised use, storage, disclosure, copying, distribution or
> > > dissemination may be unlawful.  If you are not the intended recipient
> then
> > > please notify the author by replying to this e-mail and then destroy
> any
> > > copies.
> > >
> > > Any views or opinions expressed in this e-mail are those of the author
> and
> > > do not necessarily represent those of the Trust.  All incoming and
> outgoing
> > > e-mails and other forms of telecommunication may be monitored.
> > >
> > > Warning: Although the company has taken reasonable precautions to
> ensure
> > > no viruses are present in this email, the company cannot accept
> > > responsibility for any loss or damage arising from the use of this
> email or
> > > attachments.
> > >
> > >
> > >
> > > _______________________________________________
> > > BioRuby Project - http://www.bioruby.org/
> > > BioRuby mailing list
> > > BioRuby at mailman.open-bio.org
> > > http://mailman.open-bio.org/mailman/listinfo/bioruby
> > >
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at mailman.open-bio.org
> > http://mailman.open-bio.org/mailman/listinfo/bioruby
> >
>