[BioRuby] Melting Temperature

[Pjotr Prins]

Github repository? Would be nice to add to biogems.info.

Pj.

On Thu, Oct 09, 2014 at 10:35:34AM -0400, Rob Syme wrote:
> Hi David
> 
> The 'bioroebe' gem includes Tm calculation.
> 
>     $ gem install bioroebe
>     $ irb
> 
>     > require 'bioroebe/calculate_melting_temperature'
>     > seq = 'ATGCTGACGTATGCGATCGTA'
>     > tm = CalculateMeltingTemperature.new
>     > tm.set_input(seq)
>     > tm.calculate_tm
>     # ==> 65.32166985617363
> 
> You can set oligo nucleotide concentration, Na+ conc and
> formamide_concentration.
> 
> The method isn't too complicated
> <http://rubydoc.info/gems/bioroebe/0.0.44/CalculateMeltingTemperature:calculate_tm>
> 
> Rob Syme
> 
> On Thu, Oct 9, 2014 at 6:10 AM, McCreavy David <David.McCreavy at lhch.nhs.uk>
> wrote:
> 
> > Hi Guys,
> >
> > Where in the API will I find methods for calculating Tm?
> >
> > Kind Regards, David
> >
> >
> >
> >
> >
> > ----------------------------------------------------------------------------------------------------------------
> >
> > This e-mail and any attachments may contain confidential and / or
> > proprietary Trust information, some or all of which may be legally
> > privileged, and may be subject to public disclosure under the NHS Code of
> > Openness or the Freedom of Information Act 2000.
> >
> > The information held herein should only be used for its initial intended
> > purpose(s).  It is for the exclusive use of the intended recipient(s) only
> > and any unauthorised use, storage, disclosure, copying, distribution or
> > dissemination may be unlawful.  If you are not the intended recipient then
> > please notify the author by replying to this e-mail and then destroy any
> > copies.
> >
> > Any views or opinions expressed in this e-mail are those of the author and
> > do not necessarily represent those of the Trust.  All incoming and outgoing
> > e-mails and other forms of telecommunication may be monitored.
> >
> > Warning: Although the company has taken reasonable precautions to ensure
> > no viruses are present in this email, the company cannot accept
> > responsibility for any loss or damage arising from the use of this email or
> > attachments.
> >
> >
> >
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at mailman.open-bio.org
> > http://mailman.open-bio.org/mailman/listinfo/bioruby
> >
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/bioruby
>