[BioRuby] Melting Temperature
Naohisa Goto
ngoto at gen-info.osaka-u.ac.jp
Thu Oct 9 17:21:17 UTC 2014
Hi,
I've found another implementation to calculate Tm in a blog:
http://d.hatena.ne.jp/fukuit/20101022/1287765340
Although the blog is written in Japanese, the Ruby code is clear.
The code resembles with Bioroebe's code because the same formula
is used to calculate Tm.
Naohisa Goto
ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org
> Hi David
>
> The 'bioroebe' gem includes Tm calculation.
>
> $ gem install bioroebe
> $ irb
>
> > require 'bioroebe/calculate_melting_temperature'
> > seq = 'ATGCTGACGTATGCGATCGTA'
> > tm = CalculateMeltingTemperature.new
> > tm.set_input(seq)
> > tm.calculate_tm
> # ==> 65.32166985617363
>
> You can set oligo nucleotide concentration, Na+ conc and
> formamide_concentration.
>
> The method isn't too complicated
> <http://rubydoc.info/gems/bioroebe/0.0.44/CalculateMeltingTemperature:calculate_tm>
>
> Rob Syme
>
> On Thu, Oct 9, 2014 at 6:10 AM, McCreavy David <David.McCreavy at lhch.nhs.uk>
> wrote:
>
> > Hi Guys,
> >
> > Where in the API will I find methods for calculating Tm?
> >
> > Kind Regards, David
> >
> >
> >
> >
> >
> > ----------------------------------------------------------------------------------------------------------------
> >
> > This e-mail and any attachments may contain confidential and / or
> > proprietary Trust information, some or all of which may be legally
> > privileged, and may be subject to public disclosure under the NHS Code of
> > Openness or the Freedom of Information Act 2000.
> >
> > The information held herein should only be used for its initial intended
> > purpose(s). It is for the exclusive use of the intended recipient(s) only
> > and any unauthorised use, storage, disclosure, copying, distribution or
> > dissemination may be unlawful. If you are not the intended recipient then
> > please notify the author by replying to this e-mail and then destroy any
> > copies.
> >
> > Any views or opinions expressed in this e-mail are those of the author and
> > do not necessarily represent those of the Trust. All incoming and outgoing
> > e-mails and other forms of telecommunication may be monitored.
> >
> > Warning: Although the company has taken reasonable precautions to ensure
> > no viruses are present in this email, the company cannot accept
> > responsibility for any loss or damage arising from the use of this email or
> > attachments.
> >
> >
> >
> > _______________________________________________
> > BioRuby Project - http://www.bioruby.org/
> > BioRuby mailing list
> > BioRuby at mailman.open-bio.org
> > http://mailman.open-bio.org/mailman/listinfo/bioruby
> >
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/bioruby
More information about the BioRuby
mailing list