[BioRuby] Melting Temperature

[Rob Syme]

Hi David

The 'bioroebe' gem includes Tm calculation.

    $ gem install bioroebe
    $ irb

    > require 'bioroebe/calculate_melting_temperature'
    > seq = 'ATGCTGACGTATGCGATCGTA'
    > tm = CalculateMeltingTemperature.new
    > tm.set_input(seq)
    > tm.calculate_tm
    # ==> 65.32166985617363

You can set oligo nucleotide concentration, Na+ conc and
formamide_concentration.

The method isn't too complicated
<http://rubydoc.info/gems/bioroebe/0.0.44/CalculateMeltingTemperature:calculate_tm>

Rob Syme

On Thu, Oct 9, 2014 at 6:10 AM, McCreavy David <David.McCreavy at lhch.nhs.uk>
wrote:

> Hi Guys,
>
> Where in the API will I find methods for calculating Tm?
>
> Kind Regards, David
>
>
>
>
>
> ----------------------------------------------------------------------------------------------------------------
>
> This e-mail and any attachments may contain confidential and / or
> proprietary Trust information, some or all of which may be legally
> privileged, and may be subject to public disclosure under the NHS Code of
> Openness or the Freedom of Information Act 2000.
>
> The information held herein should only be used for its initial intended
> purpose(s).  It is for the exclusive use of the intended recipient(s) only
> and any unauthorised use, storage, disclosure, copying, distribution or
> dissemination may be unlawful.  If you are not the intended recipient then
> please notify the author by replying to this e-mail and then destroy any
> copies.
>
> Any views or opinions expressed in this e-mail are those of the author and
> do not necessarily represent those of the Trust.  All incoming and outgoing
> e-mails and other forms of telecommunication may be monitored.
>
> Warning: Although the company has taken reasonable precautions to ensure
> no viruses are present in this email, the company cannot accept
> responsibility for any loss or damage arising from the use of this email or
> attachments.
>
>
>
> _______________________________________________
> BioRuby Project - http://www.bioruby.org/
> BioRuby mailing list
> BioRuby at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/bioruby
>