[Bioperl-l] how to retrieve organism name from accession number?
Chris Fields
cjfields at illinois.edu
Thu Jan 28 13:26:27 EST 2010
Russell,
Just curious, but have you tried setting the return email parameter
(-email)? NCBI recently stated that all queries would eventually
require a return email of some sort (not sure if it's validated or not).
I think that was set for around late spring. I'm changing the code in
svn to require it for that very purpose.
chris
Wed, 2010-01-27 at 15:45 +1300, Smithies, Russell wrote:
> Batch-entrez http://www.ncbi.nlm.nih.gov/portal/utils/batchentrez_p.cgi still works if you don't mind a bit of manual button clicking. It's handling chunks of 100,000 records OK (today).
>
> --Russell
>
> > -----Original Message-----
> > From: Chris Fields [mailto:cjfields at illinois.edu]
> > Sent: Wednesday, 27 January 2010 3:42 p.m.
> > To: Smithies, Russell
> > Cc: 'bioperl-l at lists.open-bio.org'; 'Mark A. Jensen'
> > Subject: Re: [Bioperl-l] how to retrieve organism name from accession
> > number?
> >
> > Makes me wonder if they're pushing more users towards the SOAP-based
> > services and away from eutils.
> >
> > chris
> >
> > On Jan 26, 2010, at 7:59 PM, Smithies, Russell wrote:
> >
> > > I've had a wide selection of errors lately:
> > >
> > > ------------- EXCEPTION: Bio::Root::Exception -------------
> > > MSG: NCBI esearch fatal error: Search Backend failed: Error 11 (Resource
> > temporarily unavailable)
> > > STACK: Error::throw
> > > STACK: Bio::Root::Root::throw
> > /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> > > STACK: Bio::Tools::EUtilities::parse_data
> > /usr/lib/perl5/site_perl/5.8.8/Bio/Tools/EUtilities.pm:332
> > > STACK: Bio::Tools::EUtilities::get_ids
> > /usr/lib/perl5/site_perl/5.8.8/Bio/Tools/EUtilities.pm:441
> > > STACK: Bio::DB::EUtilities::get_ids
> > /usr/lib/perl5/site_perl/5.8.8/Bio/DB/EUtilities.pm:363
> > > STACK: get_desc.pl:32
> > > -----------------------------------------------------------
> > >
> > > And I never get a good explanation from NCBI or suggestions on how to
> > avoid it.
> > >
> > >
> > > --Russell
> > >
> > >
> > >> -----Original Message-----
> > >> From: Chris Fields [mailto:cjfields at illinois.edu]
> > >> Sent: Wednesday, 27 January 2010 2:46 p.m.
> > >> To: Smithies, Russell
> > >> Cc: 'Mark A. Jensen'; 'bioperl-l at lists.open-bio.org'
> > >> Subject: Re: [Bioperl-l] how to retrieve organism name from accession
> > >> number?
> > >>
> > >> It's unfortunate but I have heard this problem popping up quite a bit
> > more
> > >> frequently lately. Not to push too many buttons but NCBI isn't very
> > >> forthcoming with help these days; they have become quite insular. Not
> > >> sure if they're short-staffed due to budget or if there are other
> > issues.
> > >>
> > >> chris
> > >>
> > >> On Jan 26, 2010, at 7:40 PM, Smithies, Russell wrote:
> > >>
> > >>> Grrrrrr, I hate eutils!!!!
> > >>>
> > >>> ------------- EXCEPTION: Bio::Root::Exception -------------
> > >>> MSG: NCBI esearch fatal error: Search Backend failed: Error 111
> > >> (Connection refused)
> > >>> STACK: Error::throw
> > >>> STACK: Bio::Root::Root::throw
> > >> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> > >>> STACK: Bio::Tools::EUtilities::parse_data
> > >> /usr/lib/perl5/site_perl/5.8.8/Bio/Tools/EUtilities.pm:332
> > >>> STACK: Bio::Tools::EUtilities::get_ids
> > >> /usr/lib/perl5/site_perl/5.8.8/Bio/Tools/EUtilities.pm:441
> > >>> STACK: Bio::DB::EUtilities::get_ids
> > >> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/EUtilities.pm:363
> > >>> STACK: get_desc.pl:32
> > >>> -----------------------------------------------------------
> > >>>
> > >>>
> > >>> Nice error message though :-)
> > >>>
> > >>>
> > >>> --Russell
> > >>>
> > >>>> -----Original Message-----
> > >>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > >>>> bounces at lists.open-bio.org] On Behalf Of Smithies, Russell
> > >>>> Sent: Monday, 11 January 2010 10:05 a.m.
> > >>>> To: 'Chris Fields'
> > >>>> Cc: 'Bhakti Dwivedi'; 'Mark A. Jensen'; 'bioperl-l at lists.open-
> > bio.org'
> > >>>> Subject: Re: [Bioperl-l] how to retrieve organism name from accession
> > >>>> number?
> > >>>>
> > >>>> I've started to go off eUtils recently (not BioPerl's fault) as I've
> > >> often
> > >>>> been finding that with large queries, chunks of the resulting data is
> > >>>> missing.
> > >>>> For example, before Xmas I was creating species-specific databases by
> > >>>> using eUtils to get a list of GI numbers back for a taxid, then
> > >> retrieving
> > >>>> the fasta sequences in chunks of 500.
> > >>>> Very regularly, in the middle of the fasta there would be a message
> > >> about
> > >>>> resource unavailable eg.
> > >>>>> test_sequence_1
> > >>>> TACGATCATCGCTResource UnavailableTACGACTCTGCT
> > >>>>> test_sequence_2
> > >>>> TACGTACTACGATCGATCATCACTATCGTCATACTACTACTGACT
> > >>>>
> > >>>> Often this wasn't detected until formatdb complained about invalid
> > >>>> characters.
> > >>>> Inquiries to NCBI as to why this was happening and what to do about
> > it
> > >>>> returned stupid answers ("do each sequence manually thru the web
> > >>>> interface", or "use eUtils").
> > >>>> As we have a nice fast network connection, I now prefer to download
> > >> very
> > >>>> large gzip files (i.e. all of refseq) and extract what I need.
> > >>>>
> > >>>> I can't help but think that NCBI could solve a lot of problems if
> > they
> > >>>> gzipped the output from eUtils queries - it's something I've
> > requested
> > >>>> regularly for the last 5 years or so!!
> > >>>>
> > >>>> --Russell
> > >>>>
> > >>>>
> > >>>>> -----Original Message-----
> > >>>>> From: Chris Fields [mailto:cjfields at illinois.edu]
> > >>>>> Sent: Monday, 11 January 2010 9:50 a.m.
> > >>>>> To: Smithies, Russell
> > >>>>> Cc: 'Mark A. Jensen'; 'Bhakti Dwivedi'; 'bioperl-l at lists.open-
> > bio.org'
> > >>>>> Subject: Re: [Bioperl-l] how to retrieve organism name from
> > accession
> > >>>>> number?
> > >>>>>
> > >>>>> One could also use Bio::DB::Taxonomy, which indexes the same files
> > or
> > >>>>> (alternatively) makes the eutil calls (see Bio::DB::Taxonomy POD for
> > >> the
> > >>>>> details).
> > >>>>>
> > >>>>> chris
> > >>>>>
> > >>>>> On Jan 10, 2010, at 2:34 PM, Smithies, Russell wrote:
> > >>>>>
> > >>>>>> An alternate non-BioPerly way (that may be faster given NCBI's
> > >>>> flakiness
> > >>>>> lately) would be to download the gi_taxid_nucl.zip or
> > >> gi_taxid_prot.zip
> > >>>>> files from ftp://ftp.ncbi.nih.gov/pub/taxonomy/, load them into a
> > hash
> > >>>> and
> > >>>>> do lookups.
> > >>>>>> In that same dir, taxdump.tar.gz contains a file called names.dmp
> > >>>> which
> > >>>>> lists taxids and descriptions (and synonyms)
> > >>>>>>
> > >>>>>> If it was me, I'd split gi_taxid_nucl and names.dmp into hashes so
> > I
> > >>>>> could do this:
> > >>>>>>
> > >>>>>> my $taxid = $gi_taxid_nucl{$accession};
> > >>>>>> my $org_name = $names{$taxid};
> > >>>>>>
> > >>>>>> --Russell
> > >>>>>>
> > >>>>>>
> > >>>>>>> -----Original Message-----
> > >>>>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > >>>>>>> bounces at lists.open-bio.org] On Behalf Of Mark A. Jensen
> > >>>>>>> Sent: Saturday, 26 December 2009 4:52 p.m.
> > >>>>>>> To: Bhakti Dwivedi; bioperl-l at lists.open-bio.org
> > >>>>>>> Subject: Re: [Bioperl-l] how to retrieve organism name from
> > >> accession
> > >>>>>>> number?
> > >>>>>>>
> > >>>>>>> Bhakti,
> > >>>>>>> The following example (using EUtilities) may serve your purpose:
> > >>>>>>>
> > >>>>>>> use Bio::DB::EUtilities;
> > >>>>>>>
> > >>>>>>> my (%taxa, @taxa);
> > >>>>>>> my (%names, %idmap);
> > >>>>>>>
> > >>>>>>> # these are protein ids; nuc ids will work by changing -dbfrom =>
> > >>>>>>> 'nucleotide',
> > >>>>>>> # (probably)
> > >>>>>>>
> > >>>>>>> my @ids = qw(1621261 89318838 68536103 20807972 730439);
> > >>>>>>>
> > >>>>>>> my $factory = Bio::DB::EUtilities->new(-eutil => 'elink',
> > >>>>>>> -db => 'taxonomy',
> > >>>>>>> -dbfrom => 'protein',
> > >>>>>>> -correspondence => 1,
> > >>>>>>> -id => \@ids);
> > >>>>>>>
> > >>>>>>> # iterate through the LinkSet objects
> > >>>>>>> while (my $ds = $factory->next_LinkSet) {
> > >>>>>>> $taxa{($ds->get_submitted_ids)[0]} = ($ds->get_ids)[0]
> > >>>>>>> }
> > >>>>>>>
> > >>>>>>> @taxa = @taxa{@ids};
> > >>>>>>>
> > >>>>>>> $factory = Bio::DB::EUtilities->new(-eutil => 'esummary',
> > >>>>>>> -db => 'taxonomy',
> > >>>>>>> -id => \@taxa );
> > >>>>>>>
> > >>>>>>> while (local $_ = $factory->next_DocSum) {
> > >>>>>>> $names{($_->get_contents_by_name('TaxId'))[0]} =
> > >>>>>>> ($_->get_contents_by_name('ScientificName'))[0];
> > >>>>>>> }
> > >>>>>>>
> > >>>>>>> foreach (@ids) {
> > >>>>>>> $idmap{$_} = $names{$taxa{$_}};
> > >>>>>>> }
> > >>>>>>>
> > >>>>>>> # %idmap is
> > >>>>>>> # 1621261 => 'Mycobacterium tuberculosis H37Rv'
> > >>>>>>> # 20807972 => 'Thermoanaerobacter tengcongensis MB4'
> > >>>>>>> # 68536103 => 'Corynebacterium jeikeium K411'
> > >>>>>>> # 730439 => 'Bacillus caldolyticus'
> > >>>>>>> # 89318838 => undef (this record has been removed from the
> > db)
> > >>>>>>>
> > >>>>>>> 1;
> > >>>>>>>
> > >>>>>>> You probably will need to break up your 30000 into chunks
> > >>>>>>> (say, 1000-3000 each), and do the above on each chunk with a
> > >>>>>>>
> > >>>>>>> sleep 3;
> > >>>>>>>
> > >>>>>>> or so separating the queries.
> > >>>>>>> MAJ
> > >>>>>>> ----- Original Message -----
> > >>>>>>> From: "Bhakti Dwivedi" <bhakti.dwivedi at gmail.com>
> > >>>>>>> To: <bioperl-l at lists.open-bio.org>
> > >>>>>>> Sent: Friday, December 25, 2009 9:46 PM
> > >>>>>>> Subject: [Bioperl-l] how to retrieve organism name from accession
> > >>>>> number?
> > >>>>>>>
> > >>>>>>>
> > >>>>>>>> Hi,
> > >>>>>>>>
> > >>>>>>>> Does anyone know how to retrieve the "Source" or the "Species
> > name"
> > >>>>>>> given
> > >>>>>>>> the accession number using Bioperl. I have these 30,000
> > accession
> > >>>>>>> numbers
> > >>>>>>>> for which I need to get the source organisms. Any kind of help
> > >> will
> > >>>>> be
> > >>>>>>>> appreciated.
> > >>>>>>>>
> > >>>>>>>> Thanks
> > >>>>>>>>
> > >>>>>>>> BD
> > >>>>>>>> _______________________________________________
> > >>>>>>>> Bioperl-l mailing list
> > >>>>>>>> Bioperl-l at lists.open-bio.org
> > >>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > >>>>>>>>
> > >>>>>>>>
> > >>>>>>>
> > >>>>>>> _______________________________________________
> > >>>>>>> Bioperl-l mailing list
> > >>>>>>> Bioperl-l at lists.open-bio.org
> > >>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > >>>>>>
> > >>>>
> > =======================================================================
> > >>>>>> Attention: The information contained in this message and/or
> > >>>> attachments
> > >>>>>> from AgResearch Limited is intended only for the persons or
> > entities
> > >>>>>> to which it is addressed and may contain confidential and/or
> > >>>> privileged
> > >>>>>> material. Any review, retransmission, dissemination or other use
> > of,
> > >>>> or
> > >>>>>> taking of any action in reliance upon, this information by persons
> > or
> > >>>>>> entities other than the intended recipients is prohibited by
> > >>>> AgResearch
> > >>>>>> Limited. If you have received this message in error, please notify
> > >> the
> > >>>>>> sender immediately.
> > >>>>>>
> > >>>>
> > =======================================================================
> > >>>>>>
> > >>>>>> _______________________________________________
> > >>>>>> Bioperl-l mailing list
> > >>>>>> Bioperl-l at lists.open-bio.org
> > >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > >>>>
> > >>>>
> > >>>> _______________________________________________
> > >>>> Bioperl-l mailing list
> > >>>> Bioperl-l at lists.open-bio.org
> > >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > >
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l at lists.open-bio.org
> > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
More information about the Bioperl-l
mailing list