[Bioperl-l] how to retrieve organism name from accession number?
Smithies, Russell
Russell.Smithies at agresearch.co.nz
Tue Jan 26 20:59:15 EST 2010
I've had a wide selection of errors lately:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: NCBI esearch fatal error: Search Backend failed: Error 11 (Resource temporarily unavailable)
STACK: Error::throw
STACK: Bio::Root::Root::throw /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
STACK: Bio::Tools::EUtilities::parse_data /usr/lib/perl5/site_perl/5.8.8/Bio/Tools/EUtilities.pm:332
STACK: Bio::Tools::EUtilities::get_ids /usr/lib/perl5/site_perl/5.8.8/Bio/Tools/EUtilities.pm:441
STACK: Bio::DB::EUtilities::get_ids /usr/lib/perl5/site_perl/5.8.8/Bio/DB/EUtilities.pm:363
STACK: get_desc.pl:32
-----------------------------------------------------------
And I never get a good explanation from NCBI or suggestions on how to avoid it.
--Russell
> -----Original Message-----
> From: Chris Fields [mailto:cjfields at illinois.edu]
> Sent: Wednesday, 27 January 2010 2:46 p.m.
> To: Smithies, Russell
> Cc: 'Mark A. Jensen'; 'bioperl-l at lists.open-bio.org'
> Subject: Re: [Bioperl-l] how to retrieve organism name from accession
> number?
>
> It's unfortunate but I have heard this problem popping up quite a bit more
> frequently lately. Not to push too many buttons but NCBI isn't very
> forthcoming with help these days; they have become quite insular. Not
> sure if they're short-staffed due to budget or if there are other issues.
>
> chris
>
> On Jan 26, 2010, at 7:40 PM, Smithies, Russell wrote:
>
> > Grrrrrr, I hate eutils!!!!
> >
> > ------------- EXCEPTION: Bio::Root::Exception -------------
> > MSG: NCBI esearch fatal error: Search Backend failed: Error 111
> (Connection refused)
> > STACK: Error::throw
> > STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> > STACK: Bio::Tools::EUtilities::parse_data
> /usr/lib/perl5/site_perl/5.8.8/Bio/Tools/EUtilities.pm:332
> > STACK: Bio::Tools::EUtilities::get_ids
> /usr/lib/perl5/site_perl/5.8.8/Bio/Tools/EUtilities.pm:441
> > STACK: Bio::DB::EUtilities::get_ids
> /usr/lib/perl5/site_perl/5.8.8/Bio/DB/EUtilities.pm:363
> > STACK: get_desc.pl:32
> > -----------------------------------------------------------
> >
> >
> > Nice error message though :-)
> >
> >
> > --Russell
> >
> >> -----Original Message-----
> >> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> >> bounces at lists.open-bio.org] On Behalf Of Smithies, Russell
> >> Sent: Monday, 11 January 2010 10:05 a.m.
> >> To: 'Chris Fields'
> >> Cc: 'Bhakti Dwivedi'; 'Mark A. Jensen'; 'bioperl-l at lists.open-bio.org'
> >> Subject: Re: [Bioperl-l] how to retrieve organism name from accession
> >> number?
> >>
> >> I've started to go off eUtils recently (not BioPerl's fault) as I've
> often
> >> been finding that with large queries, chunks of the resulting data is
> >> missing.
> >> For example, before Xmas I was creating species-specific databases by
> >> using eUtils to get a list of GI numbers back for a taxid, then
> retrieving
> >> the fasta sequences in chunks of 500.
> >> Very regularly, in the middle of the fasta there would be a message
> about
> >> resource unavailable eg.
> >>> test_sequence_1
> >> TACGATCATCGCTResource UnavailableTACGACTCTGCT
> >>> test_sequence_2
> >> TACGTACTACGATCGATCATCACTATCGTCATACTACTACTGACT
> >>
> >> Often this wasn't detected until formatdb complained about invalid
> >> characters.
> >> Inquiries to NCBI as to why this was happening and what to do about it
> >> returned stupid answers ("do each sequence manually thru the web
> >> interface", or "use eUtils").
> >> As we have a nice fast network connection, I now prefer to download
> very
> >> large gzip files (i.e. all of refseq) and extract what I need.
> >>
> >> I can't help but think that NCBI could solve a lot of problems if they
> >> gzipped the output from eUtils queries - it's something I've requested
> >> regularly for the last 5 years or so!!
> >>
> >> --Russell
> >>
> >>
> >>> -----Original Message-----
> >>> From: Chris Fields [mailto:cjfields at illinois.edu]
> >>> Sent: Monday, 11 January 2010 9:50 a.m.
> >>> To: Smithies, Russell
> >>> Cc: 'Mark A. Jensen'; 'Bhakti Dwivedi'; 'bioperl-l at lists.open-bio.org'
> >>> Subject: Re: [Bioperl-l] how to retrieve organism name from accession
> >>> number?
> >>>
> >>> One could also use Bio::DB::Taxonomy, which indexes the same files or
> >>> (alternatively) makes the eutil calls (see Bio::DB::Taxonomy POD for
> the
> >>> details).
> >>>
> >>> chris
> >>>
> >>> On Jan 10, 2010, at 2:34 PM, Smithies, Russell wrote:
> >>>
> >>>> An alternate non-BioPerly way (that may be faster given NCBI's
> >> flakiness
> >>> lately) would be to download the gi_taxid_nucl.zip or
> gi_taxid_prot.zip
> >>> files from ftp://ftp.ncbi.nih.gov/pub/taxonomy/, load them into a hash
> >> and
> >>> do lookups.
> >>>> In that same dir, taxdump.tar.gz contains a file called names.dmp
> >> which
> >>> lists taxids and descriptions (and synonyms)
> >>>>
> >>>> If it was me, I'd split gi_taxid_nucl and names.dmp into hashes so I
> >>> could do this:
> >>>>
> >>>> my $taxid = $gi_taxid_nucl{$accession};
> >>>> my $org_name = $names{$taxid};
> >>>>
> >>>> --Russell
> >>>>
> >>>>
> >>>>> -----Original Message-----
> >>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> >>>>> bounces at lists.open-bio.org] On Behalf Of Mark A. Jensen
> >>>>> Sent: Saturday, 26 December 2009 4:52 p.m.
> >>>>> To: Bhakti Dwivedi; bioperl-l at lists.open-bio.org
> >>>>> Subject: Re: [Bioperl-l] how to retrieve organism name from
> accession
> >>>>> number?
> >>>>>
> >>>>> Bhakti,
> >>>>> The following example (using EUtilities) may serve your purpose:
> >>>>>
> >>>>> use Bio::DB::EUtilities;
> >>>>>
> >>>>> my (%taxa, @taxa);
> >>>>> my (%names, %idmap);
> >>>>>
> >>>>> # these are protein ids; nuc ids will work by changing -dbfrom =>
> >>>>> 'nucleotide',
> >>>>> # (probably)
> >>>>>
> >>>>> my @ids = qw(1621261 89318838 68536103 20807972 730439);
> >>>>>
> >>>>> my $factory = Bio::DB::EUtilities->new(-eutil => 'elink',
> >>>>> -db => 'taxonomy',
> >>>>> -dbfrom => 'protein',
> >>>>> -correspondence => 1,
> >>>>> -id => \@ids);
> >>>>>
> >>>>> # iterate through the LinkSet objects
> >>>>> while (my $ds = $factory->next_LinkSet) {
> >>>>> $taxa{($ds->get_submitted_ids)[0]} = ($ds->get_ids)[0]
> >>>>> }
> >>>>>
> >>>>> @taxa = @taxa{@ids};
> >>>>>
> >>>>> $factory = Bio::DB::EUtilities->new(-eutil => 'esummary',
> >>>>> -db => 'taxonomy',
> >>>>> -id => \@taxa );
> >>>>>
> >>>>> while (local $_ = $factory->next_DocSum) {
> >>>>> $names{($_->get_contents_by_name('TaxId'))[0]} =
> >>>>> ($_->get_contents_by_name('ScientificName'))[0];
> >>>>> }
> >>>>>
> >>>>> foreach (@ids) {
> >>>>> $idmap{$_} = $names{$taxa{$_}};
> >>>>> }
> >>>>>
> >>>>> # %idmap is
> >>>>> # 1621261 => 'Mycobacterium tuberculosis H37Rv'
> >>>>> # 20807972 => 'Thermoanaerobacter tengcongensis MB4'
> >>>>> # 68536103 => 'Corynebacterium jeikeium K411'
> >>>>> # 730439 => 'Bacillus caldolyticus'
> >>>>> # 89318838 => undef (this record has been removed from the db)
> >>>>>
> >>>>> 1;
> >>>>>
> >>>>> You probably will need to break up your 30000 into chunks
> >>>>> (say, 1000-3000 each), and do the above on each chunk with a
> >>>>>
> >>>>> sleep 3;
> >>>>>
> >>>>> or so separating the queries.
> >>>>> MAJ
> >>>>> ----- Original Message -----
> >>>>> From: "Bhakti Dwivedi" <bhakti.dwivedi at gmail.com>
> >>>>> To: <bioperl-l at lists.open-bio.org>
> >>>>> Sent: Friday, December 25, 2009 9:46 PM
> >>>>> Subject: [Bioperl-l] how to retrieve organism name from accession
> >>> number?
> >>>>>
> >>>>>
> >>>>>> Hi,
> >>>>>>
> >>>>>> Does anyone know how to retrieve the "Source" or the "Species name"
> >>>>> given
> >>>>>> the accession number using Bioperl. I have these 30,000 accession
> >>>>> numbers
> >>>>>> for which I need to get the source organisms. Any kind of help
> will
> >>> be
> >>>>>> appreciated.
> >>>>>>
> >>>>>> Thanks
> >>>>>>
> >>>>>> BD
> >>>>>> _______________________________________________
> >>>>>> Bioperl-l mailing list
> >>>>>> Bioperl-l at lists.open-bio.org
> >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>>>>>
> >>>>>>
> >>>>>
> >>>>> _______________________________________________
> >>>>> Bioperl-l mailing list
> >>>>> Bioperl-l at lists.open-bio.org
> >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>>>
> >> =======================================================================
> >>>> Attention: The information contained in this message and/or
> >> attachments
> >>>> from AgResearch Limited is intended only for the persons or entities
> >>>> to which it is addressed and may contain confidential and/or
> >> privileged
> >>>> material. Any review, retransmission, dissemination or other use of,
> >> or
> >>>> taking of any action in reliance upon, this information by persons or
> >>>> entities other than the intended recipients is prohibited by
> >> AgResearch
> >>>> Limited. If you have received this message in error, please notify
> the
> >>>> sender immediately.
> >>>>
> >> =======================================================================
> >>>>
> >>>> _______________________________________________
> >>>> Bioperl-l mailing list
> >>>> Bioperl-l at lists.open-bio.org
> >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
More information about the Bioperl-l
mailing list