[Bioperl-l] Packaging Bio::Ext::HMM for CPAN, was Re: Problems with Bioperl-ext package on WinVista?

[Yee Man Chan]

I noticed that the $qalseq is a LocatableSeq with gaps. I don't think my program was written to support LocatableSeq with gaps. If I removed the gaps, then I would have the scores agree with each other which should be the desired outcome.

--------------------- WARNING ---------------------
MSG: In sequence ABC|9986984 residue count gives end value 104.
Overriding value [101] with value 104 for Bio::LocatableSeq::end().
TTGCCATTCTTTCGAAGCGCATTCCCTCTCGTGGCGCTGGCTTCCAGGATCTTTTGGAAGCGCATTCGACGCAACACACCTGCCCGTTTCGGGTCCGGCCCGAA
---------------------------------------------------
Getting score for ABC|9944760 -> ABC|9986984
= 291
Getting score for ABC|9986984 -> ABC|9944760
= 291

Do you think I should check for this LocatableSeq type and give an error or should I remove the gaps if this is a LocatableSeq?

Yee Man


--- On Wed, 8/19/09, Chris Fields <cjfields at illinois.edu> wrote:

> From: Chris Fields <cjfields at illinois.edu>
> Subject: Re: [Bioperl-l] Packaging Bio::Ext::HMM for CPAN, was Re:  Problems with Bioperl-ext package on WinVista?
> To: "Yee Man Chan" <ymc at yahoo.com>
> Cc: "Robert Buels" <rmb32 at cornell.edu>, "BioPerl List" <bioperl-l at lists.open-bio.org>
> Date: Wednesday, August 19, 2009, 7:49 AM
> I'll have a look.  It's probably
> something that hasn't been updated to deal with
> LocatableSeq's pathological end point checking.
> 
> chris
> 
> On Aug 19, 2009, at 4:01 AM, Yee Man Chan wrote:
> 
> > 
> > I tried that sample script that reportedly caused the
> dpAlign "bug" but I can't reproduced it. All I get is a
> warning from LocatableSeq.
> > -------------------------------------------
> > [ymc at dev Align]$ PERL_DL_NONLAZY=1 /usr/bin/perl
> "-Iblib/lib" "-Iblib/arch"
> "-I/home/ymc/bioperl/bioperl-live/trunk" test.pl
> > 
> > --------------------- WARNING ---------------------
> > MSG: In sequence ABC|9944760 residue count gives end
> value 101.
> > Overriding value [104] with value 101 for
> Bio::LocatableSeq::end().
> >
> TTGCCATTCTTTCGAAGCGCATTCCCTCTCGTGGCGCTGGCTTCCAGGATCTTTTGGAAGCGCATTCGACGCAACACACCTGCCCGTTT-GGG-CCGGCCC-AA
> > ---------------------------------------------------
> > Getting score for ABC|9944760 -> ABC|9986984
> > = 300
> > Getting score for ABC|9986984 -> ABC|9944760
> > = 303
> > ------------------------------------------
> > 
> > Does the test script crash in your machine?
> > 
> > Yee Man
> > 
> > --- On Tue, 8/18/09, Chris Fields <cjfields at illinois.edu>
> wrote:
> > 
> >> From: Chris Fields <cjfields at illinois.edu>
> >> Subject: Re: Packaging Bio::Ext::HMM for CPAN, was
> Re: [Bioperl-l] Problems with Bioperl-ext package on
> WinVista?
> >> To: "Robert Buels" <rmb32 at cornell.edu>
> >> Cc: "Yee Man Chan" <ymc at yahoo.com>,
> "BioPerl List" <bioperl-l at lists.open-bio.org>
> >> Date: Tuesday, August 18, 2009, 10:28 PM
> >> On Aug 18, 2009, at 11:37 PM, Robert
> >> Buels wrote:
> >> 
> >>> Yee Man Chan wrote:
> >>>> Is it going to be an arrangement similar
> to
> >> bioconductor? If so, I suppose then it makes
> sense. But you
> >> might want to develop scripts to automatically
> download and
> >> install new modules to make it user friendly.
> >>> Yes, we are probably going to make a
> Task::BioPerl or
> >> something similar.
> >>> 
> >>>> What do you mean by Bio-Ext is going away?
> I
> >> notice quite many people using dpAlign. So if
> Bio-Ext is
> >> going away, then at least dpAlign should become
> another spin
> >> off.
> >>> By going away, I meant that everything in
> there is
> >> going to be spinned off.  Except modules that
> are no
> >> longer maintainable, if there are any in there.
> >>> 
> >>> Rob
> >> 
> >> dpAlign could become another spinoff, yes, if it's
> used
> >> (and works fine).  The problematic code dealt
> with pSW,
> >> alignment statistics, and staden io_lib support
> (the latter
> >> which is fairly bit rotted now):
> >> 
> >> http://bugzilla.open-bio.org/show_bug.cgi?id=2668
> >> http://bugzilla.open-bio.org/show_bug.cgi?id=1857
> >> http://bugzilla.open-bio.org/show_bug.cgi?id=2069
> >> http://bugzilla.open-bio.org/show_bug.cgi?id=2074
> >> http://bugzilla.open-bio.org/show_bug.cgi?id=2329
> >> 
> >> dpAlign has it's own bug:
> >> 
> >> http://bugzilla.open-bio.org/show_bug.cgi?id=2384
> >> 
> >> chris
> >> 
> > 
> > 
> > 
> > 
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
>