[Bioperl-l] Packaging Bio::Ext::HMM for CPAN, was Re: Problems with Bioperl-ext package on WinVista?

[Chris Fields]

I'll have a look.  It's probably something that hasn't been updated to  
deal with LocatableSeq's pathological end point checking.

chris

On Aug 19, 2009, at 4:01 AM, Yee Man Chan wrote:

>
> I tried that sample script that reportedly caused the dpAlign "bug"  
> but I can't reproduced it. All I get is a warning from LocatableSeq.
> -------------------------------------------
> [ymc at dev Align]$ PERL_DL_NONLAZY=1 /usr/bin/perl "-Iblib/lib" "- 
> Iblib/arch" "-I/home/ymc/bioperl/bioperl-live/trunk" test.pl
>
> --------------------- WARNING ---------------------
> MSG: In sequence ABC|9944760 residue count gives end value 101.
> Overriding value [104] with value 101 for Bio::LocatableSeq::end().
> TTGCCATTCTTTCGAAGCGCATTCCCTCTCGTGGCGCTGGCTTCCAGGATCTTTTGGAAGCGCATTCGACGCAACACACCTGCCCGTTT 
> -GGG-CCGGCCC-AA
> ---------------------------------------------------
> Getting score for ABC|9944760 -> ABC|9986984
> = 300
> Getting score for ABC|9986984 -> ABC|9944760
> = 303
> ------------------------------------------
>
> Does the test script crash in your machine?
>
> Yee Man
>
> --- On Tue, 8/18/09, Chris Fields <cjfields at illinois.edu> wrote:
>
>> From: Chris Fields <cjfields at illinois.edu>
>> Subject: Re: Packaging Bio::Ext::HMM for CPAN, was Re: [Bioperl-l]  
>> Problems with Bioperl-ext package on WinVista?
>> To: "Robert Buels" <rmb32 at cornell.edu>
>> Cc: "Yee Man Chan" <ymc at yahoo.com>, "BioPerl List" <bioperl-l at lists.open-bio.org 
>> >
>> Date: Tuesday, August 18, 2009, 10:28 PM
>> On Aug 18, 2009, at 11:37 PM, Robert
>> Buels wrote:
>>
>>> Yee Man Chan wrote:
>>>> Is it going to be an arrangement similar to
>> bioconductor? If so, I suppose then it makes sense. But you
>> might want to develop scripts to automatically download and
>> install new modules to make it user friendly.
>>> Yes, we are probably going to make a Task::BioPerl or
>> something similar.
>>>
>>>> What do you mean by Bio-Ext is going away? I
>> notice quite many people using dpAlign. So if Bio-Ext is
>> going away, then at least dpAlign should become another spin
>> off.
>>> By going away, I meant that everything in there is
>> going to be spinned off.  Except modules that are no
>> longer maintainable, if there are any in there.
>>>
>>> Rob
>>
>> dpAlign could become another spinoff, yes, if it's used
>> (and works fine).  The problematic code dealt with pSW,
>> alignment statistics, and staden io_lib support (the latter
>> which is fairly bit rotted now):
>>
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2668
>> http://bugzilla.open-bio.org/show_bug.cgi?id=1857
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2069
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2074
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2329
>>
>> dpAlign has it's own bug:
>>
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2384
>>
>> chris
>>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l