[Bioperl-l] Bio::SeqFeature::Generic tag trouble.

[Jason Stajich]

Upgrade to bioperl 1.5.1

This is an oft reported and described bug on this mailing list....

-jason
On Oct 28, 2005, at 9:17 AM, Govind Chandra wrote:

> Hi,
>
> The script below is giving me the output shown further below. Could
> someone please point out what is it that I am doing wrong.
>
> Perl is 5.8.7. BioPerl version is 1.5.0
> Linux is RedHat 8.0
>
> Thanks
>
> Govind
> Microbiology
> John Innes Centre
> Norwich NR4 7UH
> UK
>
>
> ### script begins ###
>
> use Bio::SeqIO;
>
> $seqout=Bio::SeqIO->new('-fh' => \*STDOUT, '-format' => 'embl');
>
> $outobj=Bio::Seq->new(
> '-seq' =>  'cccgcggagcgggtaccacatcgctgcgcgatgtgcaagcgaacacccgcgctgc');
>
>
> $nft=Bio::SeqFeature::Generic->new(
> '-start' => 10,
> '-end' => 25,
> '-strand' => -1,
> '-primary' => 'CDS',
> '-tag' => {'locus_tag' => 'something',
>      'gene' => 'hoaX'}
> );
>
> $outobj->add_SeqFeature($nft);
>
> $seqout->write_seq($outobj);
> ### script ends ###
>
>
>
> ### output begins ###
> ID              standard; DNA; UNK; 55 BP.
> XX
> AC   unknown;
> XX
> XX
> FH   Key             Location/Qualifiers
> FH
> FT   CDS             complement(10..25)
> FT                   /locus_tag="Bio::Annotation::SimpleValue=HASH 
> (0x85daeac)"
> FT                   /gene="Bio::Annotation::SimpleValue=HASH 
> (0x85e1adc)"
> XX
> SQ   Sequence 55 BP; 10 A; 21 C; 18 G; 6 T; 0 other;
>      cccgcggagc gggtaccaca tcgctgcgcg atgtgcaagc gaacacccgc  
> gctgc             55
> //
> ### output ends ###
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12