[Biojava-dev] multiple alignment

[Andreas Prlic]

Hi Alessandro,

Nobody ever claimed that BioJava is doing the same as Clustal. Not sure why
you would expect that it would?

BioJava is a free project and nobody gets paid for working on it. If you
find the documentation lacking, it would be great if you could contribute
yourself. Considering the size of the project, we definitely could need
help from more volunteers!

We are working on a new tutorial on github. That should make it easy for
everybody to add or modify. In particular the chapter on alignment is only
a placeholder at this stage. Any pull request with improved documentation
will be welcome.

https://github.com/biojava/biojava-tutorial

Andreas



On Tue, Jun 16, 2015 at 7:53 PM, ALESSANDRO AIEZZA (RIT Student) <
axa9070 at rit.edu> wrote:

> I've been followig this dev for a long time waiting patiently for someone
> to *finally* realize that BioJava produces nothing like clustal in MSAs.
> It's pretty disappointing.
>
> Also, that cookbook could probably use some work. It's struggling.
>
>
> On Tuesday, June 16, 2015, stefan harjes <stefanharjes at yahoo.de> wrote:
>
>> Hi biojava,
>>
>> I am fighting with the multiple alignment of several DNASequences. When I
>> use the biojava computation I get alignments errors regarding the gaps.
>> Clustalx computes a much better result in comparison:
>>
>> biojava
>> TTGGGGCCTCTAAACGGGGTCTT
>> TTGGGGC-TCTAAC--GGGTCTT
>> TTGGGGCCTCTAAACGGG-TCTT
>>
>> clustal
>> TTGGGGCCTCTAAACGGGGTCTT
>> TTGGGG-CTCT-AACGGG-TCTT
>> TTGGGGCCTCTAAACGGG-TCTT
>> ****** **** ****
>> The most important difference is the second gap in the middle sequence,
>> which is obviously better aligned in clustal. Any hints as to how to
>> improve the biojava parameters/algorithms?
>>
>> Cheers
>> Stefan
>> p.s.
>> I already tried to implement the actual gapPenalty which clustal uses
>> which is 10/.1 for the pairwise and 10/.2 for the multiple alignment. (i.e.
>> I changed all java short types to int, scaled all scoring parameters
>> including the matrix by 10 and implemented two different gapPenalties in
>> the two alignments). Unfortunately this does not change anything.
>> Does any of you guys have a copy of the IUB scoring matrix? which would
>> be my next try?
>>
>>
>>
>
> _______________________________________________
> biojava-dev mailing list
> biojava-dev at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/biojava-dev
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.open-bio.org/pipermail/biojava-dev/attachments/20150616/c81d37be/attachment-0001.html>