[Biojava-dev] multiple alignment

[Andreas Prlic]

Hi Stefan,

what substitution matrix did you use? Nuc-4_4 ? BioJava comes with a wide
range of substitution matrices. The gap penalties depend heavily on the
choice of matrix.

https://github.com/biojava/biojava/tree/cb8da7bf718b76e35a408731c1f122b412adc884/biojava-alignment/src/main/resources

The IUB scoring matrix might be actually one of the few matrices not
supported yet, but should be easy to add if needed. Is it correct that all
matches score 1.9; all mismatches score 0?

Andreas




On Tue, Jun 16, 2015 at 6:07 PM, stefan harjes <stefanharjes at yahoo.de>
wrote:

> Hi biojava,
>
> I am fighting with the multiple alignment of several DNASequences. When I
> use the biojava computation I get alignments errors regarding the gaps.
> Clustalx computes a much better result in comparison:
>
> biojava
> TTGGGGCCTCTAAACGGGGTCTT
> TTGGGGC-TCTAAC--GGGTCTT
> TTGGGGCCTCTAAACGGG-TCTT
>
> clustal
> TTGGGGCCTCTAAACGGGGTCTT
> TTGGGG-CTCT-AACGGG-TCTT
> TTGGGGCCTCTAAACGGG-TCTT
> ****** **** ****
> The most important difference is the second gap in the middle sequence,
> which is obviously better aligned in clustal. Any hints as to how to
> improve the biojava parameters/algorithms?
>
> Cheers
> Stefan
> p.s.
> I already tried to implement the actual gapPenalty which clustal uses
> which is 10/.1 for the pairwise and 10/.2 for the multiple alignment. (i.e.
> I changed all java short types to int, scaled all scoring parameters
> including the matrix by 10 and implemented two different gapPenalties in
> the two alignments). Unfortunately this does not change anything.
> Does any of you guys have a copy of the IUB scoring matrix? which would be
> my next try?
>
>
>
> _______________________________________________
> biojava-dev mailing list
> biojava-dev at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/biojava-dev
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.open-bio.org/pipermail/biojava-dev/attachments/20150616/c1935079/attachment.html>