[Biojava-dev] multiple alignment

[ALESSANDRO AIEZZA (RIT Student)]

I've been followig this dev for a long time waiting patiently for someone
to *finally* realize that BioJava produces nothing like clustal in MSAs.
It's pretty disappointing.

Also, that cookbook could probably use some work. It's struggling.

On Tuesday, June 16, 2015, stefan harjes <stefanharjes at yahoo.de> wrote:

> Hi biojava,
>
> I am fighting with the multiple alignment of several DNASequences. When I
> use the biojava computation I get alignments errors regarding the gaps.
> Clustalx computes a much better result in comparison:
>
> biojava
> TTGGGGCCTCTAAACGGGGTCTT
> TTGGGGC-TCTAAC--GGGTCTT
> TTGGGGCCTCTAAACGGG-TCTT
>
> clustal
> TTGGGGCCTCTAAACGGGGTCTT
> TTGGGG-CTCT-AACGGG-TCTT
> TTGGGGCCTCTAAACGGG-TCTT
> ****** **** ****
> The most important difference is the second gap in the middle sequence,
> which is obviously better aligned in clustal. Any hints as to how to
> improve the biojava parameters/algorithms?
>
> Cheers
> Stefan
> p.s.
> I already tried to implement the actual gapPenalty which clustal uses
> which is 10/.1 for the pairwise and 10/.2 for the multiple alignment. (i.e.
> I changed all java short types to int, scaled all scoring parameters
> including the matrix by 10 and implemented two different gapPenalties in
> the two alignments). Unfortunately this does not change anything.
> Does any of you guys have a copy of the IUB scoring matrix? which would be
> my next try?
>
>
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.open-bio.org/pipermail/biojava-dev/attachments/20150616/f9e325f1/attachment.html>