[Biopython] Biopython local blastn query

[Ara Kooser]

This will sound like a silly question. I found the nt.nal file that lists
all the databses. How do I call the alias from biopython?

I thought it would be something like this:

nt = "/Users/arakooser/blast/db/nt.nal"

 result = NcbiblastnCommandline(task="megablast",query="-", db=nt,
                                   outfmt=5, perc_identity=100,
out="temp.xml",
                                   max_hsps_per_subject=1, num_alignments=1)

But that throws an error letting me know that nothing was returned.

ara


On Tue, Jul 30, 2013 at 10:29 AM, Ara Kooser <ghashsnaga at gmail.com> wrote:

> Peter,
>
>   Yes, a Blastwrapper update included the max_hsps_per_subject which
> wasn't in the old version I had.
>
> I removed the e-value threshold and I am still getting the same output:
>
> Thermanaeromonas toyohensis, NR_024777, 1506,
> GACGAACGCTGGCGGCGTGCCTAACACATGCAAGTCGA
> Fusibacter paucivorans, NR_024886, 1525, AGAGTTT....FULL SEQUENCE FOLLOWS
>
> What's weird is that I don't have Thermanaeromonas anywhere in my input
> file but it's being return as if it's a 100% match to something.
>
> ara
>
>
> On Tue, Jul 30, 2013 at 10:16 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:
>
>> On Tue, Jul 30, 2013 at 5:10 PM, Ara Kooser <ghashsnaga at gmail.com> wrote:
>> > Peter,
>> >
>> >   Thanks for catching that! I missed that one. I also needed to upgrade
>> to
>> > biopython 1.62b which I did.
>>
>> Really? Maybe there was a BLAST wrapper update or something relevant?
>>
>> > I still get one short sequence coming through.
>> >
>>
>> BLAST e-value thresholds are not always the best approach to filtering...
>>
>> > *General question*
>> > Hopefully one last question from me on this project. Can I query
>> multiple
>> > blast databased in a single command? I have all the nt.xx downloaded and
>> > need to query each one to look for all my sequences.
>>
>> There should be an nt.nal alias file so that you can just use "nt" as
>> the database name to search all of it.
>>
>> Peter
>>
>
>
>
> --
> Quis hic locus, quae regio, quae mundi plaga. Ubi sum. Sub ortu solis an
> sub cardine glacialis ursae.
>
> Geoscience website: http://www.tattooedscience.org/
>



-- 
Quis hic locus, quae regio, quae mundi plaga. Ubi sum. Sub ortu solis an
sub cardine glacialis ursae.

Geoscience website: http://www.tattooedscience.org/