[Biopython] Biopython local blastn query

[Ara Kooser]

Peter,

  Yes, a Blastwrapper update included the max_hsps_per_subject which wasn't
in the old version I had.

I removed the e-value threshold and I am still getting the same output:

Thermanaeromonas toyohensis, NR_024777, 1506,
GACGAACGCTGGCGGCGTGCCTAACACATGCAAGTCGA
Fusibacter paucivorans, NR_024886, 1525, AGAGTTT....FULL SEQUENCE FOLLOWS

What's weird is that I don't have Thermanaeromonas anywhere in my input
file but it's being return as if it's a 100% match to something.

ara


On Tue, Jul 30, 2013 at 10:16 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Tue, Jul 30, 2013 at 5:10 PM, Ara Kooser <ghashsnaga at gmail.com> wrote:
> > Peter,
> >
> >   Thanks for catching that! I missed that one. I also needed to upgrade
> to
> > biopython 1.62b which I did.
>
> Really? Maybe there was a BLAST wrapper update or something relevant?
>
> > I still get one short sequence coming through.
> >
>
> BLAST e-value thresholds are not always the best approach to filtering...
>
> > *General question*
> > Hopefully one last question from me on this project. Can I query multiple
> > blast databased in a single command? I have all the nt.xx downloaded and
> > need to query each one to look for all my sequences.
>
> There should be an nt.nal alias file so that you can just use "nt" as
> the database name to search all of it.
>
> Peter
>



-- 
Quis hic locus, quae regio, quae mundi plaga. Ubi sum. Sub ortu solis an
sub cardine glacialis ursae.

Geoscience website: http://www.tattooedscience.org/