[Bioperl-l] Proposed improvement to to Bio::Tools::Run::Primer3Redux

[Chris Fields]

Frank,

You are more than welcome to look at the code on github and improve it.  In fact, let me know if you have a github account and I can add you as a collaborator (John, same for you).  I'll probably work on conversion to Dist::Zilla at some point for easier distribution building, but will keep a stub Build.PL for easy installation from github if needed.

Key thing I want to make sure we keep up is tests and test coverage.  Could probably improve the backend a bit more as well, but it works for now.

chris 

On Feb 1, 2011, at 8:22 AM, Frank Schwach wrote:

> Hi John and Chris,
> 
> I was wondering about the state of affairs with this new
> Bio-Tools-Primer3Redux module. I need to run and parse Primer3 v2.xx as
> well and I also need the SEQUENCE_PRIMER_PAIR_OK_REGION_LIST function. I
> was about to put together a module for my own use when I saw your
> messages. So, if there is anything I can do to help with this I would be
> happy to do so (instead of re-inventing the wheel). 
> 
> Frank
> 
> 
> 
> On Mon, 2011-01-24 at 12:41 -0600, Chris Fields wrote:
>> John,
>> 
>> This patch is made off an older version of Bio-Tools-Primer3Redux, which is now hosted in a separate repo on GitHub:
>> 
>> https://github.com/cjfields/Bio-Tools-Primer3Redux
>> 
>> I get one patch failure against the latest code which is easily added (the SEQUENCE_PRIMER_PAIR_OK_REGION_LIST parameter), but tests now fail (see below).  Can you resubmit this against the latest code?
>> 
>> chris
>> 
>> 
>> $ ./Build test --test-files t/Run/Primer3Redux.t --verbose
>> t/Run/Primer3Redux.t .. Subroutine p3_settings_file redefined at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 620.
>> 
>> ok 1 - use Bio::Tools::Run::Primer3Redux;
>> ok 2
>> ok 3 - program_name
>> SEQUENCE_ID=Test1
>> 
>> SEQUENCE_TEMPLATE=AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
>> 
>> PRIMER_EXPLAIN_FLAG=1
>> 
>> PRIMER_PRODUCT_SIZE_RANGE=100-250
>> 
>> PRIMER_SALT_CORRECTIONS=1
>> 
>> PRIMER_TASK=pick_pcr_primers
>> 
>> PRIMER_TM_FORMULA=1
>> 
>> =
>> Unknown open() mode '/Users/cjfields/bin/primer3_core  </var/folders/Nj/Njn+dA2IGey0Gxn+92zej++++TI/-Tmp-/NAGb_w_8Rs' at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 705.
>> # Tests were run but no plan was declared and done_testing() was not seen.
>> Dubious, test returned 255 (wstat 65280, 0xff00)
>> All 3 subtests passed 
>> 
>> Test Summary Report
>> -------------------
>> t/Run/Primer3Redux.t (Wstat: 65280 Tests: 3 Failed: 0)
>>  Non-zero exit status: 255
>>  Parse errors: No plan found in TAP output
>> Files=1, Tests=3,  1 wallclock secs ( 0.02 usr  0.01 sys +  0.20 cusr  0.04 csys =  0.27 CPU)
>> Result: FAIL
>> Failed 1/1 test programs. 0/3 subtests failed.
>> 
>> On Jan 24, 2011, at 11:44 AM, Ma, Man Chun John wrote:
>> 
>>> Hi,
>>> 
>>> Attached are my proposed diff for some changes for Bio::Tools::Run::Primer3Redux to more fully implement the new features of Primer3 version 2.x.x:
>>> 
>>> 1. Adding support for the commond-line argument p3_settings_file that has been available for all 2.x.x versions, and
>>> 2. Adding support for the "Sequence" tag SEQUENCE_PRIMER_PAIR_OK_REGION_LIST, a new function in version 2.2.3
>>> 
>>> Although I have used this module quite heavily in my projects and it appeared to run well, I'm not sure if there are bugs--not to say I have yet understand how to write /t scripts, so I wonder if someone would like to test this up.
>>> 
>>> Cheers,
>>> 
>>> John MC Ma
>>> Graduate Assistant
>>> Kwitek Lab
>>> Department of Internal Medicine
>>> 3125E MERF
>>> 375 Newton Road
>>> Iowa City IA 52242<Primer3Redux.patch>_______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 
> -- 
> The Wellcome Trust Sanger Institute is operated by Genome Research 
> Limited, a charity registered in England with number 1021457 and a 
> company registered in England with number 2742969, whose registered 
> office is 215 Euston Road, London, NW1 2BE.