[Bioperl-l] Proposed improvement to to Bio::Tools::Run::Primer3Redux

[Frank Schwach]

Hi John and Chris,

I was wondering about the state of affairs with this new
Bio-Tools-Primer3Redux module. I need to run and parse Primer3 v2.xx as
well and I also need the SEQUENCE_PRIMER_PAIR_OK_REGION_LIST function. I
was about to put together a module for my own use when I saw your
messages. So, if there is anything I can do to help with this I would be
happy to do so (instead of re-inventing the wheel). 

Frank



On Mon, 2011-01-24 at 12:41 -0600, Chris Fields wrote:
> John,
> 
> This patch is made off an older version of Bio-Tools-Primer3Redux, which is now hosted in a separate repo on GitHub:
> 
> https://github.com/cjfields/Bio-Tools-Primer3Redux
> 
> I get one patch failure against the latest code which is easily added (the SEQUENCE_PRIMER_PAIR_OK_REGION_LIST parameter), but tests now fail (see below).  Can you resubmit this against the latest code?
> 
> chris
> 
> 
> $ ./Build test --test-files t/Run/Primer3Redux.t --verbose
> t/Run/Primer3Redux.t .. Subroutine p3_settings_file redefined at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 620.
> 
> ok 1 - use Bio::Tools::Run::Primer3Redux;
> ok 2
> ok 3 - program_name
> SEQUENCE_ID=Test1
> 
> SEQUENCE_TEMPLATE=AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
> 
> PRIMER_EXPLAIN_FLAG=1
> 
> PRIMER_PRODUCT_SIZE_RANGE=100-250
> 
> PRIMER_SALT_CORRECTIONS=1
> 
> PRIMER_TASK=pick_pcr_primers
> 
> PRIMER_TM_FORMULA=1
> 
> =
> Unknown open() mode '/Users/cjfields/bin/primer3_core  </var/folders/Nj/Njn+dA2IGey0Gxn+92zej++++TI/-Tmp-/NAGb_w_8Rs' at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 705.
> # Tests were run but no plan was declared and done_testing() was not seen.
> Dubious, test returned 255 (wstat 65280, 0xff00)
> All 3 subtests passed 
> 
> Test Summary Report
> -------------------
> t/Run/Primer3Redux.t (Wstat: 65280 Tests: 3 Failed: 0)
>   Non-zero exit status: 255
>   Parse errors: No plan found in TAP output
> Files=1, Tests=3,  1 wallclock secs ( 0.02 usr  0.01 sys +  0.20 cusr  0.04 csys =  0.27 CPU)
> Result: FAIL
> Failed 1/1 test programs. 0/3 subtests failed.
> 
> On Jan 24, 2011, at 11:44 AM, Ma, Man Chun John wrote:
> 
> > Hi,
> > 
> > Attached are my proposed diff for some changes for Bio::Tools::Run::Primer3Redux to more fully implement the new features of Primer3 version 2.x.x:
> > 
> > 1. Adding support for the commond-line argument p3_settings_file that has been available for all 2.x.x versions, and
> > 2. Adding support for the "Sequence" tag SEQUENCE_PRIMER_PAIR_OK_REGION_LIST, a new function in version 2.2.3
> > 
> > Although I have used this module quite heavily in my projects and it appeared to run well, I'm not sure if there are bugs--not to say I have yet understand how to write /t scripts, so I wonder if someone would like to test this up.
> > 
> > Cheers,
> > 
> > John MC Ma
> > Graduate Assistant
> > Kwitek Lab
> > Department of Internal Medicine
> > 3125E MERF
> > 375 Newton Road
> > Iowa City IA 52242<Primer3Redux.patch>_______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE.