[Bioperl-l] How to Obtain Nucleotide Sequence from SeqIO::fastq

[Roy Chaudhuri]

Hi Alan,

It sounds like there's a problem with reading in your Fastq file. Are 
you using the latest BioPerl version? There have been many bug fixes to 
Bio::SeqIO::fastq over the last couple of years. If you are using an 
up-to-date BioPerl, please could you send an example Fastq entry which 
gives the error messages?

Roy.

On 27/07/2010 15:37, Alan Twaddle wrote:
> Whenever I try to access the sequence I get the following error message:
>
>
> --------------------- WARNING ---------------------
> MSG: Seq/Qual descriptions don't match; using sequence description
>
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: Fastq sequence/quality data length mismatch error
>
> ---------------------------------------------------
>
> --------------------- WARNING ---------------------
> MSG: seq doesn't validate with [0-9A-Za-z\*\-\.=~\\/\?], mismatch is +
> ---------------------------------------------------
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Attempting to set the sequence to
> [+GCGAAGAACCTTACCTACTCTTGACATCCAGAGAATTCGCTAGAGATAGCTTAGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTATCCTTTGTTGCCAGCGAGTAATGTCGGGAACTCAAAGGAGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATGACGTCAACTCATCATGCCCCTTGCTGATAC]
> which does not look healthy
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:357
> STACK: Bio::PrimarySeq::seq /usr/lib/perl5/site_perl/5.8.8/Bio/PrimarySeq.pm:270
> STACK: Bio::PrimarySeq::new /usr/lib/perl5/site_perl/5.8.8/Bio/PrimarySeq.pm:221
> STACK: Bio::LocatableSeq::new
> /usr/lib/perl5/site_perl/5.8.8/Bio/LocatableSeq.pm:109
> STACK: Bio::Seq::Meta::Array::new
> /usr/lib/perl5/site_perl/5.8.8/Bio/Seq/Meta/Array.pm:167
> STACK: Bio::Seq::Quality::new
> /usr/lib/perl5/site_perl/5.8.8/Bio/Seq/Quality.pm:191
> STACK: Bio::Seq::SeqFactory::create
> /usr/lib/perl5/site_perl/5.8.8/Bio/Seq/SeqFactory.pm:116
> STACK: Bio::SeqIO::fastq::next_seq
> /usr/lib/perl5/site_perl/5.8.8/Bio/SeqIO/fastq.pm:151
> STACK: fastQParser.pl:12
>
>
>
> On Tue, Jul 27, 2010 at 10:16 AM, Roy Chaudhuri<roy.chaudhuri at gmail.com>  wrote:
>> Hi Alan,
>>
>> Another case for the deobfuscator:
>> http://bioperl.org/cgi-bin/deob_interface.cgi
>>
>> A Bio::Seq::Quality object is a Bio::PrimarySeq, so you can just say
>> $seqqual->seq to get the sequence as a string.
>>
>> Cheers.
>> Roy.
>>
>> On 27/07/2010 15:10, Alan Twaddle wrote:
>>>
>>> Hello,
>>>
>>>       I am curious as to how I am supposed to use SeqIO::fastq to read
>>> in a fastq file and then obtain the nucleotide sequence from that. I
>>> noticed that SeqIO::fastq returns a Seq::Quality object but I haven't
>>> seen a method within that module that returns the nucleotide sequence.
>>> Please, let me know if you have any suggestions!
>>>
>>> Thank you very much!!
>>>
>>
>>
>
>
>