[Bioperl-l] Alignment from blast report

[Paolo Pavan]

Sorry,
Maybe I forgot to add this is the megablast -m 5 output.

Thank you again,
Paolo

2010/2/26 Paolo Pavan <paolo.pavan at gmail.com>:
> Hi all,
> I have just a brief question: I've got some megablast reports such the
> one I've pasted below.
> I'm aware of the existence of the Bio::Search::IO::megablast and the
> Bio::Search::HSP::BlastHSP::get_aln but, is there a way to get the
> entire alignment represented as a Bio::SimpleAlign object or
> Bio::Align::AlignI implementing one?
>
> Thank you all,
> Paolo
>
>
> MEGABLAST 2.2.16 [Mar-25-2007]
>
>
> Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000),
> "A greedy algorithm for aligning DNA sequences",
> J Comput Biol 2000; 7(1-2):203-14.
>
> Database: 00038-00053.fasta
>            2 sequences; 2001 total letters
>
> Searching..................................................done
>
> Query= 00038-00053
>          (802 letters)
>
>
>
>                                                                  Score    E
> Sequences producing significant alignments:                      (bits) Value
>
> ______00038
> 226   1e-62
> ______00053
> 115   3e-29
>
> 1_0         472
> ccgacaataattcttgttggaatcttcggcagttttttgtacaggagccagtagttcaaa 531
> ______00038 883
> ccgacaataattcttgttggaatcttcggcagttttttgtacaggagccagtagttcaaa 942
> ______00053      ------------------------------------------------------------
>
> 1_0         532
> aagaaagcgatcaataaaa-taaaaatcacaaaaaaattaccaaaaacatatttataaat 590
> ______00038 943
> aagaaagcgatcaataaaaataaaaatcacaaaaaaattaccaaaaacatatttataaa- 1001
> ______00053      ------------------------------------------------------------
>
> 1_0         591
> attggcaaaaaaattgccaacaattcccaaacggaaaattcccaaaacaaagagagcgtc 650
> ______00038 1000
> ------------------------------------------------------------ 1001
> ______00053      ------------------------------------------------------------
>
> 1_0         651
> gataaccaatatcaaaatagtttttgaatttattttttgtgtttttttagtttttcttct 710
> ______00038 1000
> ------------------------------------------------------------ 1001
> ______00053      ------------------------------------------------------------
>
> 1_0         711
> acgtcgtgttgccatttatccagcattaagtctataaaaaaaaacggtcagataaaaatg 770
> ______00038 1000
> ------------------------------------------------------------ 1001
> ______00053 1    -------------------------ttaagtctataaaaaaaa-cggtcagataaaaatg 34
>
> 1_0         771  ccttaagtatttactttaacttgtcttgatca 802
> ______00038 1000 -------------------------------- 1001
> ______00053 35   ccttaagtatt-actttaacttgtcttgatca 65
>   Database: 00038-00053.fasta
>     Posted date:  Feb 25, 2010  4:47 PM
>   Number of letters in database: 2001
>   Number of sequences in database:  2
>
> Lambda     K      H
>     1.37    0.711     1.31
>
> Gapped
> Lambda     K      H
>     1.37    0.711     1.31
>
>
> Matrix: blastn matrix:1 -3
> Gap Penalties: Existence: 0, Extension: 0
> Number of Sequences: 2
> Number of Hits to DB: 17
> Number of extensions: 3
> Number of successful extensions: 3
> Number of sequences better than 10.0: 2
> Number of HSP's gapped: 2
> Number of HSP's successfully gapped: 2
> Length of query: 802
> Length of database: 2001
> Length adjustment: 10
> Effective length of query: 792
> Effective length of database: 1981
> Effective search space:  1568952
> Effective search space used:  1568952
> X1: 9 (17.8 bits)
> X2: 20 (39.6 bits)
> X3: 51 (101.1 bits)
> S1: 9 (18.3 bits)
> S2: 9 (18.3 bits)
>