[Bioperl-l] Alignment from blast report

[Paolo Pavan]

Hi all,
I have just a brief question: I've got some megablast reports such the
one I've pasted below.
I'm aware of the existence of the Bio::Search::IO::megablast and the
Bio::Search::HSP::BlastHSP::get_aln but, is there a way to get the
entire alignment represented as a Bio::SimpleAlign object or
Bio::Align::AlignI implementing one?

Thank you all,
Paolo


MEGABLAST 2.2.16 [Mar-25-2007]


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000),
"A greedy algorithm for aligning DNA sequences",
J Comput Biol 2000; 7(1-2):203-14.

Database: 00038-00053.fasta
           2 sequences; 2001 total letters

Searching..................................................done

Query= 00038-00053
         (802 letters)



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

______00038
226   1e-62
______00053
115   3e-29

1_0         472
ccgacaataattcttgttggaatcttcggcagttttttgtacaggagccagtagttcaaa 531
______00038 883
ccgacaataattcttgttggaatcttcggcagttttttgtacaggagccagtagttcaaa 942
______00053      ------------------------------------------------------------

1_0         532
aagaaagcgatcaataaaa-taaaaatcacaaaaaaattaccaaaaacatatttataaat 590
______00038 943
aagaaagcgatcaataaaaataaaaatcacaaaaaaattaccaaaaacatatttataaa- 1001
______00053      ------------------------------------------------------------

1_0         591
attggcaaaaaaattgccaacaattcccaaacggaaaattcccaaaacaaagagagcgtc 650
______00038 1000
------------------------------------------------------------ 1001
______00053      ------------------------------------------------------------

1_0         651
gataaccaatatcaaaatagtttttgaatttattttttgtgtttttttagtttttcttct 710
______00038 1000
------------------------------------------------------------ 1001
______00053      ------------------------------------------------------------

1_0         711
acgtcgtgttgccatttatccagcattaagtctataaaaaaaaacggtcagataaaaatg 770
______00038 1000
------------------------------------------------------------ 1001
______00053 1    -------------------------ttaagtctataaaaaaaa-cggtcagataaaaatg 34

1_0         771  ccttaagtatttactttaacttgtcttgatca 802
______00038 1000 -------------------------------- 1001
______00053 35   ccttaagtatt-actttaacttgtcttgatca 65
  Database: 00038-00053.fasta
    Posted date:  Feb 25, 2010  4:47 PM
  Number of letters in database: 2001
  Number of sequences in database:  2

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 0, Extension: 0
Number of Sequences: 2
Number of Hits to DB: 17
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 2
Number of HSP's gapped: 2
Number of HSP's successfully gapped: 2
Length of query: 802
Length of database: 2001
Length adjustment: 10
Effective length of query: 792
Effective length of database: 1981
Effective search space:  1568952
Effective search space used:  1568952
X1: 9 (17.8 bits)
X2: 20 (39.6 bits)
X3: 51 (101.1 bits)
S1: 9 (18.3 bits)
S2: 9 (18.3 bits)