[Bioperl-l] Next-gen modules

[Chris Fields]

On Jun 24, 2009, at 9:56 AM, Peter wrote:

> On Wed, Jun 24, 2009 at 12:48 PM, Peter Rice<pmr at ebi.ac.uk> wrote:
>>
>> I was planning to suggest a get-together at BOSC in Stockholm so we  
>> can
>> identify common cross-platform issues. I'm sure there are many ways  
>> we
>> can conform with naming and interfaces and perhaps even share code.
>>
>
> That would be a good idea - but while there are quite a few Biopython
> people at BOSC this year, I don't know if there will be many from  
> BioPerl
> (there isn't a BioPerl update talk scheduled).

Most of us are caught up with other work, though I will likely be able  
to dedicate more time to it in the ext few months.

Also doesn't help that my travel stipend doesn't start until Aug. 1.

>>>>>> We also allow the integer quality score format ... is anyone  
>>>>>> still
>>>>>> using that (it looks horrible to me :-)
>>>>> Do you mean the QUAL file format holding PHRED scores?
>>>>> Roche provide tools to turn their SFF files into FASTA and
>>>>> QUAL files, so they are still used.
>>>> Probably ... unless there is a Solexa version too.
>>>
>>> We may be talking at cross purposes here, this is QUAL format:
>>> http://www.bioperl.org/wiki/Qual_sequence_format
>>
>> Yes that is different. We'll worry about separate QUAL files later  
>> (we
>> already find separate GFF files a pain for features) and still with  
>> the
>> "fastqint" format name.
>
> So when you say "fastqint" are you talking about something else?
> Could you show us an example record in this format?
>
> Peter
> [I need to remember to proof read my evening emails more carefully]

The same as fastq, except the ASCII quality is converted to actual  
score:

@4_1_912_360
AAGGGGCTAGAGAAACACGTAATGAAGGGAGGACTC
+4_1_912_360
40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 21 40 40 40  
40 40 40 40 40 40 26 40 40 14 39 40 40
@4_1_54_483
TAATAAATGTGCTTCCTTGATGCATGTGCTATGATT
+4_1_54_483
40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 40 40 40  
28 40 40 40 40 40 40 16 40 40 5 40 40
chris