[Bioperl-l] Bio::Restriction::Analysis. Exception when usingrebasefile.
Mark A. Jensen
maj at fortinbras.us
Sun Jun 14 04:35:18 UTC 2009
All-
I'm finding this is requiring a pretty substantial refactor and
rationalization. I have opened a branch at
REPOS/bioperl-live/branches/restriction-refactor
and am making commits at will there (won't Rob be pleased!).
When it appears to be passing tests, I'll let Chris know (on list),
and he can decide on its mergability, and brave users could try
it out by downloading Bio/Restriction (deeply) via subversion.
My running commentary is at Bug #2855.
MAJ
----- Original Message -----
From: "Chris Fields" <cjfields at illinois.edu>
To: "Mark A. Jensen" <maj at fortinbras.us>
Cc: <bioperl-l at lists.open-bio.org>; "Rasmus Ory Nielsen" <ron at ron.dk>
Sent: Thursday, June 11, 2009 10:19 AM
Subject: Re: [Bioperl-l] Bio::Restriction::Analysis. Exception when
usingrebasefile.
> Mark,
>
> Feel free to take it up. It's probably a good idea to start a bug report for
> tracking if it proves to be thornier to fix than expected.
>
> chris
>
> On Jun 11, 2009, at 8:17 AM, Mark A. Jensen wrote:
>
>> Rasmus et al-
>>
>> This looks like a bug. A quick debug shows it's barfing on 'AarI' (as it
>> cycles through
>> all enzymes apparently creating a global cut map). AarI has a recognition
>> sequence of
>>
>> CACCTGC (in $enz->seq->seq)
>>
>> but a cut site of
>>
>> CACCTGCNNNN^ (in $enz->seq->site)
>>
>> The bad parm '11' refers to the end of the cut site sequence, but the
>> routine
>> B:R:Analysis::_cuts is attempting to split the 7-symbol recognition
>> sequence,
>> and so throws.
>>
>> This surprises me. Core, let me know if you want me to take this on, or
>> if the module author can fix it quicker.
>>
>> cheers,
>> Mark
>>
>> ----- Original Message ----- From: "Rasmus Ory Nielsen" <ron at ron.dk>
>> To: <bioperl-l at lists.open-bio.org>
>> Sent: Wednesday, June 10, 2009 3:35 AM
>> Subject: [Bioperl-l] Bio::Restriction::Analysis. Exception when using
>> rebasefile.
>>
>>
>>> Hi,
>>>
>>> This is my first time using bioperl for restriction analysis, so please
>>> bear with me, if this is a FAQ.
>>>
>>> I downloaded withrefm.906 from ftp://ftp.neb.com/pub/rebase/ and created
>>> the script shown at the bottom of the mail.
>>> My bioperl version is bioperl-live nightly from 09-Jun-2009.
>>>
>>> The scripts throws an exception - see below. But, if I comment out the
>>> '-enzymes' argument, so it uses the built-in collection of enzymes, it
>>> works.
>>>
>>> My problem is, that I need to use some of the enzymes that are only
>>> available in rebase. So how do I get this working?
>>>
>>> Thanks for your attention.
>>>
>>> Best regards,
>>> Rasmus Ory Nielsen
>>>
>>>
>>> ############################################################
>>> Output from the script:
>>> ############################################################
>>>
>>> [roni at ksdhcp ~]$ ./restriction_test.pl
>>>
>>> --------------------- WARNING ---------------------
>>> MSG: The enzyme name CviKI-1 was changed to CviKI-I
>>> ---------------------------------------------------
>>>
>>> ------------- EXCEPTION -------------
>>> MSG: Bad end parameter (11). End must be less than the total length of
>>> sequence (total=7)
>>> STACK Bio::PrimarySeq::subseq /usr/local/lib/perl5/site_perl/5.10.0/
>>> Bio/PrimarySeq.pm:401
>>> STACK Bio::Restriction::Analysis::_enzyme_sites /usr/local/lib/
>>> perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:900
>>> STACK Bio::Restriction::Analysis::_cuts /usr/local/lib/perl5/
>>> site_perl/5.10.0/Bio/Restriction/Analysis.pm:801
>>> STACK Bio::Restriction::Analysis::cut /usr/local/lib/perl5/
>>> site_perl/5.10.0/Bio/Restriction/Analysis.pm:379
>>> STACK Bio::Restriction::Analysis::fragment_maps /usr/local/lib/
>>> perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:515
>>> STACK toplevel ./restriction_test.pl:30
>>> -------------------------------------
>>>
>>> [roni at ksdhcp ~]$
>>>
>>>
>>> ############################################################
>>> Output from the script with the '-enzymes' argument commented out
>>> ############################################################
>>>
>>> [roni at ksdhcp ~]$ ./restriction_test.pl
>>>
>>> --------------------- WARNING ---------------------
>>> MSG: The enzyme name CviKI-1 was changed to CviKI-I
>>> ---------------------------------------------------
>>> $VAR1 = [
>>> {
>>> 'seq' => 'CTCGACCGTTAGCAA',
>>> 'end' => 15,
>>> 'start' => '1'
>>> },
>>> {
>>> 'seq' => 'AGCTTTCTACCGTTATCGT',
>>> 'end' => 34,
>>> 'start' => '16'
>>> }
>>> ];
>>> [roni at ksdhcp ~]$
>>>
>>> ############################################################
>>>
>>> #!/usr/bin/perl
>>> use strict;
>>> use warnings;
>>> use Bio::PrimarySeq;
>>> use Bio::Restriction::IO;
>>> use Bio::Restriction::Analysis;
>>> use Data::Dumper;
>>>
>>> # create seq obj
>>> my $seqobj = new Bio::PrimarySeq(
>>> -seq => 'CTCGACCGTTAGCAAAGCTTTCTACCGTTATCGT',
>>> -primary_id => 'test',
>>> -molecule => 'dna'
>>> );
>>>
>>> # read rebase file
>>> my $rebase_io = Bio::Restriction::IO->new(
>>> -file => 'withrefm.906',
>>> -format => 'withrefm',
>>> );
>>> my $rebase_collection = $rebase_io->read;
>>>
>>> # start restriction analysis
>>> my $restriction_analysis = Bio::Restriction::Analysis->new(
>>> -seq => $seqobj,
>>> -enzymes => $rebase_collection, # it works with this line commented
>>> out
>>> );
>>>
>>> # retrieve fragment maps
>>> my @fragment_maps = $restriction_analysis->fragment_maps('HindIII');
>>> print Dumper \@fragment_maps;
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
More information about the Bioperl-l
mailing list