[Bioperl-l] Bio::Restriction::Analysis. Exception when using rebasefile.

[Mark A. Jensen]

All-righty-- thanks MAJ
----- Original Message ----- 
From: "Chris Fields" <cjfields at illinois.edu>
To: "Mark A. Jensen" <maj at fortinbras.us>
Cc: "Rasmus Ory Nielsen" <ron at ron.dk>; <bioperl-l at lists.open-bio.org>
Sent: Thursday, June 11, 2009 10:19 AM
Subject: Re: [Bioperl-l] Bio::Restriction::Analysis. Exception when using 
rebasefile.


> Mark,
>
> Feel free to take it up.  It's probably a good idea to start a bug  report for 
> tracking if it proves to be thornier to fix than expected.
>
> chris
>
> On Jun 11, 2009, at 8:17 AM, Mark A. Jensen wrote:
>
>> Rasmus et al-
>>
>> This looks like a bug. A quick debug shows it's barfing on  'AarI' (as it 
>> cycles through
>> all enzymes apparently creating a global cut map). AarI has a  recognition 
>> sequence of
>>
>> CACCTGC (in $enz->seq->seq)
>>
>> but a cut site of
>>
>> CACCTGCNNNN^ (in $enz->seq->site)
>>
>> The bad parm '11' refers to the end of the cut site sequence, but  the 
>> routine
>> B:R:Analysis::_cuts is attempting to split the 7-symbol recognition 
>> sequence,
>> and so throws.
>>
>> This surprises me. Core, let me know if you want me to take this on,  or
>> if the module author can fix it quicker.
>>
>> cheers,
>> Mark
>>
>> ----- Original Message ----- From: "Rasmus Ory Nielsen" <ron at ron.dk>
>> To: <bioperl-l at lists.open-bio.org>
>> Sent: Wednesday, June 10, 2009 3:35 AM
>> Subject: [Bioperl-l] Bio::Restriction::Analysis. Exception when  using 
>> rebasefile.
>>
>>
>>> Hi,
>>>
>>> This is my first time using bioperl for restriction analysis, so  please 
>>> bear with me, if this is a FAQ.
>>>
>>> I downloaded withrefm.906 from ftp://ftp.neb.com/pub/rebase/ and  created 
>>> the script shown at the bottom of the mail.
>>> My bioperl version is bioperl-live nightly from 09-Jun-2009.
>>>
>>> The scripts throws an exception - see below. But, if I comment out  the 
>>> '-enzymes' argument, so it uses the built-in collection of  enzymes, it 
>>> works.
>>>
>>> My problem is, that I need to use some of the enzymes that are only 
>>> available in rebase. So how do I get this working?
>>>
>>> Thanks for your attention.
>>>
>>> Best regards,
>>> Rasmus Ory Nielsen
>>>
>>>
>>> ############################################################
>>> Output from the script:
>>> ############################################################
>>>
>>> [roni at ksdhcp ~]$ ./restriction_test.pl
>>>
>>> --------------------- WARNING ---------------------
>>> MSG: The enzyme name CviKI-1 was changed to CviKI-I
>>> ---------------------------------------------------
>>>
>>> ------------- EXCEPTION -------------
>>> MSG: Bad end parameter (11). End must be less than the total length  of 
>>> sequence (total=7)
>>> STACK Bio::PrimarySeq::subseq /usr/local/lib/perl5/site_perl/5.10.0/ 
>>> Bio/PrimarySeq.pm:401
>>> STACK Bio::Restriction::Analysis::_enzyme_sites /usr/local/lib/ 
>>> perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:900
>>> STACK Bio::Restriction::Analysis::_cuts /usr/local/lib/perl5/ 
>>> site_perl/5.10.0/Bio/Restriction/Analysis.pm:801
>>> STACK Bio::Restriction::Analysis::cut /usr/local/lib/perl5/ 
>>> site_perl/5.10.0/Bio/Restriction/Analysis.pm:379
>>> STACK Bio::Restriction::Analysis::fragment_maps /usr/local/lib/ 
>>> perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:515
>>> STACK toplevel ./restriction_test.pl:30
>>> -------------------------------------
>>>
>>> [roni at ksdhcp ~]$
>>>
>>>
>>> ############################################################
>>> Output from the script with the '-enzymes' argument commented out
>>> ############################################################
>>>
>>> [roni at ksdhcp ~]$ ./restriction_test.pl
>>>
>>> --------------------- WARNING ---------------------
>>> MSG: The enzyme name CviKI-1 was changed to CviKI-I
>>> ---------------------------------------------------
>>> $VAR1 = [
>>>          {
>>>            'seq' => 'CTCGACCGTTAGCAA',
>>>            'end' => 15,
>>>            'start' => '1'
>>>          },
>>>          {
>>>            'seq' => 'AGCTTTCTACCGTTATCGT',
>>>            'end' => 34,
>>>            'start' => '16'
>>>          }
>>>        ];
>>> [roni at ksdhcp ~]$
>>>
>>> ############################################################
>>>
>>> #!/usr/bin/perl
>>> use strict;
>>> use warnings;
>>> use Bio::PrimarySeq;
>>> use Bio::Restriction::IO;
>>> use Bio::Restriction::Analysis;
>>> use Data::Dumper;
>>>
>>> # create seq obj
>>> my $seqobj = new Bio::PrimarySeq(
>>>    -seq        => 'CTCGACCGTTAGCAAAGCTTTCTACCGTTATCGT',
>>>    -primary_id => 'test',
>>>    -molecule   => 'dna'
>>> );
>>>
>>> # read rebase file
>>> my $rebase_io = Bio::Restriction::IO->new(
>>>    -file   => 'withrefm.906',
>>>    -format => 'withrefm',
>>> );
>>> my $rebase_collection = $rebase_io->read;
>>>
>>> # start restriction analysis
>>> my $restriction_analysis = Bio::Restriction::Analysis->new(
>>>    -seq     => $seqobj,
>>>    -enzymes => $rebase_collection,    # it works with this line  commented 
>>> out
>>> );
>>>
>>> # retrieve fragment maps
>>> my @fragment_maps = $restriction_analysis->fragment_maps('HindIII');
>>> print Dumper \@fragment_maps;
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>