[Bioperl-l] Bio::Restriction refactor [Was: Bio::Restriction::Analysis. Exception when using rebasefile.]

[Mark A. Jensen]

Dear All,

The revamped Bio::Restriction::* in branch

REPOS/bioperl-live/branches/restriction-refactor

passes all existing tests, including those in t/Restriction.
New tests will be added within the next day or so.
The original bug occurred because only a subset of
the possible rebase withrefm-formatted enzymes were
handled; it choked on freshly-downloaded rebase
files because of this.

The refactored version now handles *all* rebase types,
including those of rebase forms

XXX^X                [ intrasite cutters, the main types
                               built in to base.pm]
XXXX(m/n)          [ right-end extrasite cutters ]
(s/t)XXXX            [ left-end ditto ]
(s/t)XXXX(m/n)    [ double-end ditto],

palindromic and non-palindromic, as well as multisite
enzymes that string together combinations of these
forms. Much rationalization (well, seems rational to me
anyway) and cruft removal in the affected code has also
occurred. itype2.pm has been updated as well, to
conform to the refactoring.

If you're dying to try this now, get a working copy
of the branch like so

$ svn co 
svn://code.open-bio.org/bioperl/bioperl-live/branches/restriction-refactor 
bioperl-rr
$ cd bioperl-rr
$ perl Build.PL
$ ./Build test
$ ./Build install

This will only hammer your current installation in the
$SITE_LIB/Bio/Restriction path; I worked only on
a sparse checkout of the necessary files. To revert to your
old install, do

$ cd $MY_OLD_BIOPERL_WORKINGDIR
$ ./Build install

[In the possible event that these instructions are in error,
there will be a response on this list in a matter of
milliseconds, so stand by.]

Happy coding-
Mark




----- Original Message ----- 
From: "Rasmus Ory Nielsen" <ron at ron.dk>
To: <bioperl-l at lists.open-bio.org>
Sent: Wednesday, June 10, 2009 3:35 AM
Subject: [Bioperl-l] Bio::Restriction::Analysis. Exception when using 
rebasefile.


> Hi,
>
> This is my first time using bioperl for restriction analysis, so please bear 
> with me, if this is a FAQ.
>
> I downloaded withrefm.906 from ftp://ftp.neb.com/pub/rebase/ and created the 
> script shown at the bottom of the mail.
> My bioperl version is bioperl-live nightly from 09-Jun-2009.
>
> The scripts throws an exception - see below. But, if I comment out the 
> '-enzymes' argument, so it uses the built-in collection of enzymes, it works.
>
> My problem is, that I need to use some of the enzymes that are only available 
> in rebase. So how do I get this working?
>
> Thanks for your attention.
>
> Best regards,
> Rasmus Ory Nielsen
>
>
> ############################################################
> Output from the script:
> ############################################################
>
> [roni at ksdhcp ~]$ ./restriction_test.pl
>
> --------------------- WARNING ---------------------
> MSG: The enzyme name CviKI-1 was changed to CviKI-I
> ---------------------------------------------------
>
> ------------- EXCEPTION -------------
> MSG: Bad end parameter (11). End must be less than the total length of 
> sequence (total=7)
> STACK Bio::PrimarySeq::subseq 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/PrimarySeq.pm:401
> STACK Bio::Restriction::Analysis::_enzyme_sites 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:900
> STACK Bio::Restriction::Analysis::_cuts 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:801
> STACK Bio::Restriction::Analysis::cut 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:379
> STACK Bio::Restriction::Analysis::fragment_maps 
> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:515
> STACK toplevel ./restriction_test.pl:30
> -------------------------------------
>
> [roni at ksdhcp ~]$
>
>
> ############################################################
> Output from the script with the '-enzymes' argument commented out
> ############################################################
>
> [roni at ksdhcp ~]$ ./restriction_test.pl
>
> --------------------- WARNING ---------------------
> MSG: The enzyme name CviKI-1 was changed to CviKI-I
> ---------------------------------------------------
> $VAR1 = [
>           {
>             'seq' => 'CTCGACCGTTAGCAA',
>             'end' => 15,
>             'start' => '1'
>           },
>           {
>             'seq' => 'AGCTTTCTACCGTTATCGT',
>             'end' => 34,
>             'start' => '16'
>           }
>         ];
> [roni at ksdhcp ~]$
>
> ############################################################
>
> #!/usr/bin/perl
> use strict;
> use warnings;
> use Bio::PrimarySeq;
> use Bio::Restriction::IO;
> use Bio::Restriction::Analysis;
> use Data::Dumper;
>
> # create seq obj
> my $seqobj = new Bio::PrimarySeq(
>     -seq        => 'CTCGACCGTTAGCAAAGCTTTCTACCGTTATCGT',
>     -primary_id => 'test',
>     -molecule   => 'dna'
> );
>
> # read rebase file
> my $rebase_io = Bio::Restriction::IO->new(
>     -file   => 'withrefm.906',
>     -format => 'withrefm',
> );
> my $rebase_collection = $rebase_io->read;
>
> # start restriction analysis
> my $restriction_analysis = Bio::Restriction::Analysis->new(
>     -seq     => $seqobj,
>     -enzymes => $rebase_collection,    # it works with this line commented out
> );
>
> # retrieve fragment maps
> my @fragment_maps = $restriction_analysis->fragment_maps('HindIII');
> print Dumper \@fragment_maps;
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>