[Bioperl-l] Bio::Restriction refactor [Was:Bio::Restriction::Analysis. Exception when using rebasefile.]
Mark A. Jensen
maj at fortinbras.us
Tue Jun 16 13:58:56 EDT 2009
Dear All,
There are tests for the new functionality of Bio::Restriction
now in t/Restriction on the branch, along with the withrefm.906
in t/data that revealed the bug in RON's post. All tests pass without
warnings on my machine (which is bioperl live, perl 5.10.10,
under Vista/cygwin - yes, I still don't have a real computer).
We're ready for a merge on my end.
Thanks all for your silent assent to these machinations.
cheers
Mark
----- Original Message -----
From: "Mark A. Jensen" <maj at fortinbras.us>
To: "Rasmus Ory Nielsen" <ron at ron.dk>; <bioperl-l at lists.open-bio.org>
Sent: Monday, June 15, 2009 7:49 PM
Subject: [Bioperl-l] Bio::Restriction refactor [Was:Bio::Restriction::Analysis.
Exception when using rebasefile.]
> Dear All,
>
> The revamped Bio::Restriction::* in branch
>
> REPOS/bioperl-live/branches/restriction-refactor
>
> passes all existing tests, including those in t/Restriction.
> New tests will be added within the next day or so.
> The original bug occurred because only a subset of
> the possible rebase withrefm-formatted enzymes were
> handled; it choked on freshly-downloaded rebase
> files because of this.
>
> The refactored version now handles *all* rebase types,
> including those of rebase forms
>
> XXX^X [ intrasite cutters, the main types
> built in to base.pm]
> XXXX(m/n) [ right-end extrasite cutters ]
> (s/t)XXXX [ left-end ditto ]
> (s/t)XXXX(m/n) [ double-end ditto],
>
> palindromic and non-palindromic, as well as multisite
> enzymes that string together combinations of these
> forms. Much rationalization (well, seems rational to me
> anyway) and cruft removal in the affected code has also
> occurred. itype2.pm has been updated as well, to
> conform to the refactoring.
>
> If you're dying to try this now, get a working copy
> of the branch like so
>
> $ svn co
> svn://code.open-bio.org/bioperl/bioperl-live/branches/restriction-refactor
> bioperl-rr
> $ cd bioperl-rr
> $ perl Build.PL
> $ ./Build test
> $ ./Build install
>
> This will only hammer your current installation in the
> $SITE_LIB/Bio/Restriction path; I worked only on
> a sparse checkout of the necessary files. To revert to your
> old install, do
>
> $ cd $MY_OLD_BIOPERL_WORKINGDIR
> $ ./Build install
>
> [In the possible event that these instructions are in error,
> there will be a response on this list in a matter of
> milliseconds, so stand by.]
>
> Happy coding-
> Mark
>
>
>
>
> ----- Original Message -----
> From: "Rasmus Ory Nielsen" <ron at ron.dk>
> To: <bioperl-l at lists.open-bio.org>
> Sent: Wednesday, June 10, 2009 3:35 AM
> Subject: [Bioperl-l] Bio::Restriction::Analysis. Exception when using
> rebasefile.
>
>
>> Hi,
>>
>> This is my first time using bioperl for restriction analysis, so please bear
>> with me, if this is a FAQ.
>>
>> I downloaded withrefm.906 from ftp://ftp.neb.com/pub/rebase/ and created the
>> script shown at the bottom of the mail.
>> My bioperl version is bioperl-live nightly from 09-Jun-2009.
>>
>> The scripts throws an exception - see below. But, if I comment out the
>> '-enzymes' argument, so it uses the built-in collection of enzymes, it works.
>>
>> My problem is, that I need to use some of the enzymes that are only available
>> in rebase. So how do I get this working?
>>
>> Thanks for your attention.
>>
>> Best regards,
>> Rasmus Ory Nielsen
>>
>>
>> ############################################################
>> Output from the script:
>> ############################################################
>>
>> [roni at ksdhcp ~]$ ./restriction_test.pl
>>
>> --------------------- WARNING ---------------------
>> MSG: The enzyme name CviKI-1 was changed to CviKI-I
>> ---------------------------------------------------
>>
>> ------------- EXCEPTION -------------
>> MSG: Bad end parameter (11). End must be less than the total length of
>> sequence (total=7)
>> STACK Bio::PrimarySeq::subseq
>> /usr/local/lib/perl5/site_perl/5.10.0/Bio/PrimarySeq.pm:401
>> STACK Bio::Restriction::Analysis::_enzyme_sites
>> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:900
>> STACK Bio::Restriction::Analysis::_cuts
>> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:801
>> STACK Bio::Restriction::Analysis::cut
>> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:379
>> STACK Bio::Restriction::Analysis::fragment_maps
>> /usr/local/lib/perl5/site_perl/5.10.0/Bio/Restriction/Analysis.pm:515
>> STACK toplevel ./restriction_test.pl:30
>> -------------------------------------
>>
>> [roni at ksdhcp ~]$
>>
>>
>> ############################################################
>> Output from the script with the '-enzymes' argument commented out
>> ############################################################
>>
>> [roni at ksdhcp ~]$ ./restriction_test.pl
>>
>> --------------------- WARNING ---------------------
>> MSG: The enzyme name CviKI-1 was changed to CviKI-I
>> ---------------------------------------------------
>> $VAR1 = [
>> {
>> 'seq' => 'CTCGACCGTTAGCAA',
>> 'end' => 15,
>> 'start' => '1'
>> },
>> {
>> 'seq' => 'AGCTTTCTACCGTTATCGT',
>> 'end' => 34,
>> 'start' => '16'
>> }
>> ];
>> [roni at ksdhcp ~]$
>>
>> ############################################################
>>
>> #!/usr/bin/perl
>> use strict;
>> use warnings;
>> use Bio::PrimarySeq;
>> use Bio::Restriction::IO;
>> use Bio::Restriction::Analysis;
>> use Data::Dumper;
>>
>> # create seq obj
>> my $seqobj = new Bio::PrimarySeq(
>> -seq => 'CTCGACCGTTAGCAAAGCTTTCTACCGTTATCGT',
>> -primary_id => 'test',
>> -molecule => 'dna'
>> );
>>
>> # read rebase file
>> my $rebase_io = Bio::Restriction::IO->new(
>> -file => 'withrefm.906',
>> -format => 'withrefm',
>> );
>> my $rebase_collection = $rebase_io->read;
>>
>> # start restriction analysis
>> my $restriction_analysis = Bio::Restriction::Analysis->new(
>> -seq => $seqobj,
>> -enzymes => $rebase_collection, # it works with this line commented
>> out
>> );
>>
>> # retrieve fragment maps
>> my @fragment_maps = $restriction_analysis->fragment_maps('HindIII');
>> print Dumper \@fragment_maps;
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
More information about the Bioperl-l
mailing list