[Bioperl-l] ncbi blastn problem.

Chris Fields cjfields at uiuc.edu
Fri Jan 19 10:30:51 EST 2007


Note these two lines in the BLAST output:

Number of sequences better than 0.001: 0
Number of HSP's better than 0.001 without gapping: 0

The default expect values are set differently for BLAST web page  
submissions (10) vs the URLAPI version (0.001).  Use the parameter '- 
expect' to change that:

my $factory = Bio::Tools::Run::RemoteBlast->new(
'-prog' => 'blastn',
'-data' => 'nr',
'-readmethod' => 'blast',
'-expect' => 10
);

chris

On Jan 19, 2007, at 7:20 AM, Cristian Gary wrote:

> i have a problem with the result of the analisis  in the ncbi  
> blastn  with
> Bio::Tools::Run::RemoteBlast that is only with de alignement of  
> nucleotide -
> nucleotide , i dont have any  problem with blastp.
>
> ncbi return , "No significant similarity found." but when i send  
> the same
> fasta file with the ncbi webpage , return the correct alignement.
> any help.
>
> " this is an example  that i find .... and  learning...."
>
> use Bio::Tools::Run::RemoteBlast;
> use Bio::SeqIO;
>
>
> my $Seq_in = Bio::SeqIO->new (-file => 'fasta/prueba.fasta',
> -format => 'fasta');
> my $query = $Seq_in->next_seq();
>
> my $factory = Bio::Tools::Run::RemoteBlast->new(
> '-prog' => 'blastn',
> '-data' => 'nr',
> _READMETHOD => "Blast",
>
> );
> my $blast_report = $factory->submit_blast($query);
> my $max_number = 100;
> my $trial = 0;
>
>
> while ( my @rids = $factory->each_rid ) {
>
> print STDERR "\nSorry, maximum number of retries $max_number  
> exceeded\n" if
> $trial >= $max_number;
> last if $trial >= $max_number;
> $trial++;
>
> print STDERR "waiting... ".(5*$trial)." units of time\n" ;
> # RID = Remote Blast ID (e.g: 1017772174-16400-6638)
> foreach my $rid ( @rids ) {
> my $rc = $factory->retrieve_blast($rid);
> if( !ref($rc) ) {
> if( $rc < 0 ) {
> # retrieve_blast returns -1 on error
> $factory->remove_rid($rid);
> }
> # retrieve_blast returns 0 on 'job not finished'
> sleep 5*$trial;
> } else {
>
> #---- Blast done ----
>
> $factory->remove_rid($rid);
> my $result = $rc->next_result;
> print "database: ", $result->database_name(), "\n";
> print "letterzs: " , $result->database_letters(), "\n";
> print "entradas: ", $result->database_entries(),"\n";
> print "@rids" , "\n";
>
> while( my $hit = $result->next_hit ) {
> print "hit name is: ", $hit->name, "\n";
> while( my $hsp = $hit->next_hsp ) {
> print "score is: ", $hsp->score, "\n";
> }
> }
> }
> }
> }
>
>
> FASTA:::
>
>> Problema
> cagctcacccgcgccgccagagaggggcgcattcgcagtatccccggttttggggagaaaaccgaagcgc 
> gcatcctgga
> agccctccaggcccagatcgccgccgttccccgttttcccatcgccgtcgccgccccgtatgccgctgcc 
> ctggtccgct
> atctgcagaacgtacccggtgtgcggcgggtggtggtggccggcagcttccgacgcggcagggatacggt 
> gggcgacctg
> gatatactggctacggccactgcagacagcccggtcatggaacgcttcaccgcctatgaggatgtggcgg 
> aagtgttct
>
>
>
>
> -- 
> "El conocimiento le pertecene  a la humanidad"
>
> "Gnu/linux   -------- free your mind......
> www.kubuntu.org
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign






More information about the Bioperl-l mailing list