[Bioperl-l] ncbi blastn problem.

Cristian Gary cristiangary at gmail.com
Fri Jan 19 08:20:02 EST 2007


i have a problem with the result of the analisis  in the ncbi blastn  with
Bio::Tools::Run::RemoteBlast that is only with de alignement of nucleotide -
nucleotide , i dont have any  problem with blastp.

ncbi return , "No significant similarity found." but when i send the same
fasta file with the ncbi webpage , return the correct alignement.
any help.

" this is an example  that i find .... and  learning...."

use Bio::Tools::Run::RemoteBlast;
use Bio::SeqIO;


my $Seq_in = Bio::SeqIO->new (-file => 'fasta/prueba.fasta',
-format => 'fasta');
my $query = $Seq_in->next_seq();

my $factory = Bio::Tools::Run::RemoteBlast->new(
'-prog' => 'blastn',
'-data' => 'nr',
_READMETHOD => "Blast",

);
my $blast_report = $factory->submit_blast($query);
my $max_number = 100;
my $trial = 0;


while ( my @rids = $factory->each_rid ) {

print STDERR "\nSorry, maximum number of retries $max_number exceeded\n" if
$trial >= $max_number;
last if $trial >= $max_number;
$trial++;

print STDERR "waiting... ".(5*$trial)." units of time\n" ;
# RID = Remote Blast ID (e.g: 1017772174-16400-6638)
foreach my $rid ( @rids ) {
my $rc = $factory->retrieve_blast($rid);
if( !ref($rc) ) {
if( $rc < 0 ) {
# retrieve_blast returns -1 on error
$factory->remove_rid($rid);
}
# retrieve_blast returns 0 on 'job not finished'
sleep 5*$trial;
} else {

#---- Blast done ----

$factory->remove_rid($rid);
my $result = $rc->next_result;
print "database: ", $result->database_name(), "\n";
print "letterzs: " , $result->database_letters(), "\n";
print "entradas: ", $result->database_entries(),"\n";
print "@rids" , "\n";

while( my $hit = $result->next_hit ) {
print "hit name is: ", $hit->name, "\n";
while( my $hsp = $hit->next_hsp ) {
print "score is: ", $hsp->score, "\n";
}
}
}
}
}


FASTA:::

>Problema
cagctcacccgcgccgccagagaggggcgcattcgcagtatccccggttttggggagaaaaccgaagcgcgcatcctgga
agccctccaggcccagatcgccgccgttccccgttttcccatcgccgtcgccgccccgtatgccgctgccctggtccgct
atctgcagaacgtacccggtgtgcggcgggtggtggtggccggcagcttccgacgcggcagggatacggtgggcgacctg
gatatactggctacggccactgcagacagcccggtcatggaacgcttcaccgcctatgaggatgtggcggaagtgttct




-- 
"El conocimiento le pertecene  a la humanidad"

"Gnu/linux   -------- free your mind......
www.kubuntu.org



More information about the Bioperl-l mailing list