[BioPython] Tm for BioPython

[Sebastian Bassi]

I want to write a DNA melting temperature (Tm) calculator function for 
BioPython.
The problem is that different programs use diferent formulae to get the Tm.

GCG uses:
         Proc.Natl. Acad. Sci. USA. 95; 1460-1465 (1986)):
T(m)(oligo) = delta H / ((delta S' + R x ln(c/4)) - 273.15
where delta H is the enthalpy of helix formation, delta S' is the 
salt-adjusted entropy of helix formation (including helix initiation), R 
is the molar gas constant (1.987 cal/degree Celsius/mol), and c is the 
oligonucleotide concentration.
The salt-adjusted delta S' is determined from the delta S at 1M salt 
according to the equation:
delta S' = delta S + (0.368 x (oligo_length - 1) x ln[K(+)])
where [K(+)] is the potassium ion concentration.

ACCCTTCAGCAGTTCCACAC = 54.3 C


DAN (from EMBOSS) uses:
Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A. (1986). 
"Predicting DNA Duplex Stability from the Base Sequence." Proceedings of 
the National Academy of Sciences USA 83, 3746-3750.

from the source code:
	if(isproduct)
	{
	    TmP1 = 81.5 + 16.6 * (float)log10((double)(salt/1000.0)) + 0.41 *
		cga[*np];
	    TmP2 = -(0.65 * formamide) - (675.0/fprodlen) - mismatch;
	    tpa[*np] = TmP1 + TmP2;


ACCCTTCAGCAGTTCCACAC = 59.2 C
ggtaccgctggccgagcatc = 64.9 C

Primer3 also has diferent numbers.

I also have some working code on Python, but I'd like Brad, Jeff or 
somebody to tell me witch ecuation to use. All the thermodynamic 
constants seems to agree in diferent works, so the only problem is the 
main formaulae.



-- 
Best regards,

//=\ Sebastian Bassi - Diplomado en Ciencia y Tecnologia, UNQ   //=\
\=// IT Manager Advanta Seeds - Balcarce Research Center -      \=//
//=\ Pro secretario ASALUP - www.asalup.org - PGP key available //=\
\=// E-mail: sbassi at genesdigitales.com - ICQ UIN: 3356556 -     \=//

                 http://Bioinformatica.info