[EMBOSS] fuzznuc and sequence ID
    Philippe DESSEN 
    dessen at igr.fr
       
    Mon Jun 10 10:28:34 UTC 2013
    
    
  
Dear all,
I use fuzznuc to find some patterns in an extract of the human genome  as a fasta file with several parts :
>chr1:562520-566670
GGAGTGGTAGCTCTCAGTATAGTCAGCCTCTAAGAAGAGAGCAAATGTTT
ATTTTCAAGAAGAATTATGCAGAAAGGGCCACTTTCAGTCTACCATCCCC
CCAGATTCCTTGAAGGCAGGATGATGTGAGCAGCAAGGGAAGAAAGGGGA
GTGGGCACGAAATACTACAGAACCTGCAGGGAACGAAGTCCCTCTGTCTG
;..
>
Curiously the report of fuzznuc  (default)  is like that   without the same identifier as on the fasta file 
########################################
# Program: fuzznuc
# Rundate: Mon Jun 10 2013 11:56:52
# Commandline: fuzznuc
#    [-sequence] xxxx.fdr01peaks.hg19.fasta
#    -pattern xxxxxxx
#    -complement
#    -outfile fuzz.txt
# Report_format: seqtable
# Report_file: _fuzz.txt
########################################
#=======================================
#
# Sequence:  Sequence: 562520-566670     from: 1   to: 4151
# HitCount: 0
#
#
It is not possible to localize the segment on the full genome without the chromosome !!
--
Best 
Philippe Dessen
IGR, Villejuif, France
    
    
More information about the EMBOSS
mailing list