[EMBOSS] Conservation of FASTQ scores by the EMBOSS tools.

[Charles Plessy]

Dear EMBOSS developers,

I have multi-sequence file in FASTQ format that contains sequencing reads, and
would like to retreive them the with seqret. But as you see in the following
example, quality scores are not preserved:

$ seqret P13-CA.fq:F1EZY7316JY25B fastq::stdout
Reads and writes (returns) sequences
@F1EZY7316JY25B rank=0000040 x=3973.0 y=285.0 length=68
AATGATACGGCGACCACCGAACACTGCGTTTGCTGGCTTTGATGCACTTCTCATGGCCAATTTCATTG
+
""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""

The purpose was to use seqret as a workaround for the fact that vectorstrip
does not keep the quality either.

Do you think that it would be possible to get this functionality as a patch in
the future, or is it big work that needs to wait for the next release?

Have a nice day,

-- 
Charles Plessy
Tsurumi, Kanagawa, Japan