[EMBOSS] EMBOSS seqret : IntelliGenetics and new DOS lines

[Peter]

Peter Rice wrote:
>
> Peter C. wrote:
>> However, if we now convert this input file to use DOS/Windows
>> newlines, and repeat the test (on Mac OS X, so Unix):
>>
>> $ embossversionReports the current EMBOSS version number
>> 6.1.0
>> $ seqret -sequence emboss_ig.txt -sformat ig -osformat fasta -auto -filter
>>  H.sapiens fau mRNA, 518 bases
>> ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
>>
>> i.e. The ">" is missing on all the FASTA sequences.
>
> Actually, it's not missing ... it is hiding.
>
> The sequence id has a ^M appended to it, so the '> and the id get
> overwritten by the description when you look at the file.

That makes sense, and I think I can see how it might have happened.

> Fixed by processing the IG format ID rather than simply copying it.
>
> Thanks for finding that one.

Sure,

Peter C.