[EMBOSS] can vectorstrip trim only a substring of the adapter?

[Zhou Xiang]

Hi all,

I used the vectorstrip to trim the 3' adapter off the sequences.
But it seemed that the program searched for the existence of the entire
adapter.

For example, if i have the read: CCCCCTTTTTAAAAAGGGGG
And 3' adapter is: CCAAAGGG
The program will not trim the read to CCCCCTTTTTAA
Because it does not use the substring "AAAGGG" in the adapter sequence.

Any comments about this? How can i trim only a substring of the adapter?
I hope it can search for the longest match, but substring matches should
also be accepted if no entire adapter is found in the sequence.
Thanks!

-Xiang