[EMBOSS] new format EMBL flat files index

[Olivier Friard]

Hi,

I try to make indexes for the release 87 of EMBL with new first line format:

* I downloaded EMBOSS-3.0.0

* gunzip, tar xvf ...

* I replaced the files with the files in the fixes directory

* ./configure --prefix= .... ,make, make install

* I indexed my rel_std_*.dat files (db name: embl) with dbiflat

* I wrote a emboss.default file for embl db (showdb works)

but when I try the seqret application I obtained this output:

 >.1; .1; Human cytomegalovirus strain AD169 complete genome
gggccgcgtggtgggtcctcgaggggcgggggggtgtttttagcgggggggtgaaacttg
gagttgcgtgtgtggacggcgactagttgcgtgtggtgcggaggacggcgacggcgaata
aaagcgacgtgcggcgcgcacggcgaaaagaagacgcgtgtctgtgtctgtgtgattccc
...

I tried to index these new files with EMBLNEW format (in place of EMBL) 
as specified in the README file in the fixes directory but it is not a 
valid format.

Does anyone index the new format EMBL flat file successfully?

Thank you for the help

Olivier



-- 

Olivier Friard
Laboratorio di Biologia Computazionale - Facoltà di Scienze MFN
Università di Torino
via Accademia Albertina 13, 10124 TORINO (Italy)

tel. +39 011 6704689
http://www.personalweb.unito.it/olivier.friard/