[EMBOSS] Testing as if user - Antigenic
    Aengus Stewart 
    aengus.stewart at cancer.org.uk
       
    Wed Aug 20 16:50:37 UTC 2003
    
    
  
Hi,
I am going through the software attempting to test it as if I was a user
ie doing the things I shouldnt.
I have just given antigenic a DNA seq rather than a PROT seq and it
gives at first glance what appears to be a reasonable result file.
########################################
# Program: antigenic
# Rundate: Wed Aug 20 17:49:57 2003
# Report_format: motif
# Report_file: btmg.dna.antigenic
########################################
#=======================================
#
# Sequence: BTMG     from: 1   to: 1077
# HitCount: 35
#=======================================
Max_score_pos at "*"
(1) Score 1.362 length 48 at bases 519->566
                            *
 Sequence: CTTCCATGGCTAAGCCCCACCCCTGTGCCCCTCACCCCACCCACCTGG
           |                                              |
         519                                              566
(2) Score 1.335 length 30 at bases 10->39
                                  *
 Sequence: GAGACAGACACCCAGTCAGTCCCGCCCTTG
           |                            |
          10                            39
It has recognised that the file was DNA rather than PROT as it has bases
rather than residues in the headers. 
However having detected that the sequence is DNA should it run at all?
Aengus
    
    
More information about the EMBOSS
mailing list