Piping with emboss utilites that expect two files as input
    Estienne Swart 
    estienne at sanbi.ac.za
       
    Mon Sep  9 09:53:43 UTC 2002
    
    
  
Hi,
Is there any way to directly pipe two sequences into utitilities such as 
water/matcher, etc. which require usually require two files as input? It 
is possible to pipe one or the other (seqA or seqB, e.g.water -auto 
-filter -SeqA sample1.seq < sample2.seq  ), but no both at once 
(e.g.water -auto -filter < sample1.seq < sample2.seq ).
I know not all shells can read from multiple pipes(?), like zsh can, e.g.:
cat < sample2.seq <sample1.seq
 >A less simple sequence
ACGAGCACTAGCATGCATCGAGCATCGGGAGGACTTAGCAGTCGAGCATCGTACGAGCT
 >A simple sequence
AGAGGCAGGCGACGAGCGAGCGAGCGAGC
But, it will really be useful (from a scripting perspective) if these 
utilities could at least take a pair of sequences from stdin, and align 
them.
Estienne Swart
    
    
More information about the EMBOSS
mailing list