reverse numbering

[Stefanie Lager]

Hi,

I saw that GCG and EMBOSS use different numbering system when
reversing sequences. If I align 2 sequences, using water from EMBOOS
and bestfit from GCG, and ask to use the reverse strand of sequence 2.
All EMBOSS programs reverse and complements sequence 2, giving it a
new numbering. 
While bestfit (and other GCG programs) just compares the opposite
strand but keeps the numbering according to the ORIGINAL strand. 

Is it possible to keep the numbering according to the original strand
also in EMBOSS programs, when comparing the reverse strand?

Stefanie

########################################
# Program:  water
# Rundate:  Fri Dec 06 16:50:52 2002
# Report_file: A_B.water
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: A.seq
# 2: B.seq
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 0.5
#
# Length: 33
# Identity:      33/33 (100.0%)
# Similarity:    33/33 (100.0%)
# Gaps:           0/33 ( 0.0%)
# Score: 165.0
# 
#
#=======================================

A.seq            268 gcccaggagagccaaaaagccgagctggaaggc    300
                     |||||||||||||||||||||||||||||||||
B.seq              1 gcccaggagagccaaaaagccgagctggaaggc     33


#---------------------------------------
#---------------------------------------


 BESTFIT of: A.gcg  check: 5728  from: 1  to: 420
 
A.seq
 
 to reverse of: B.gcg2  check: 1476  from: 1  to: 33
 
B.seq

 Symbol comparison table: /disk4/gcg/gcgcore/data/rundata/swgapdna.cmp
 CompCheck: 2335

         Gap Weight:     50      Average Match: 10.000
      Length Weight:      3   Average Mismatch: -9.000

            Quality:    330             Length:     33
              Ratio: 10.000               Gaps:      0
 Percent Similarity: 100.000   Percent Identity: 100.000

        Match display thresholds for the alignment(s):
                    | = IDENTITY
                    : =   5
                    . =   1

 A.gcg x B.gcg2            December 6, 2002 16:51  ..

                  .         .         .   
     268 gcccaggagagccaaaaagccgagctggaaggc 300
         |||||||||||||||||||||||||||||||||
      33 gcccaggagagccaaaaagccgagctggaaggc 1
_________________________________________________________________
    http://fastmail.ca/ - Fast Secure Web Email for Canadians