[DAS2] Sequence retrieval proposal
Nomi Harris
nomi at fruitfly.org
Thu Dec 8 14:13:05 EST 2005
On 8 December 2005, Thomas Down wrote:
> > There's already a huge number of existing sequence file formats.
> > What would another provide? Are some of them already extensible?
> >
> > Several of those formats are designed and developed by people involved
> > with DAS. If it's important, extend GAME or GFF.
>
> Do GAME or GFF have a sequence representation? I thought they were
> both primarily feature-table formats
GAME certainly has a sequence representation, and i think GFF3 must,
though old GFF doesn't.
<game>
<seq id="3R:1178000-1230000" length="52001" focus="true">
<name>3R:1178000-1230000</name>
<organism>Drosophila melanogaster</organism>
<residues>
AAGCCCACTATATTGCATTAAATTATGCGATAATTGATCAATTTTAAAGG
...
</residues>
> (right now I'm having trouble
> finding the GAME documentation though...).
http://www.fruitfly.org/annot/apollo/game.rng.txt
Nomi
More information about the DAS2
mailing list