[BioRuby] Remote Blast

[Anthony Underwood]

Hello Naohisa


Thanks for your full and clear response. Unfortunately I really do  
need to query the nr nucleotide database.

I am currently working on a exec_ncbi method. Might be a chance to  
test the github forking and merging process!

Thanks again


Anthony
On 4 Jul 2008, at 15:05, Naohisa GOTO wrote:

> Hi,
>
> On Fri, 4 Jul 2008 13:13:45 +0100
> Anthony Underwood <email2ants at gmail.com> wrote:
>
>> Hi all, is remote blast broken for bioruby?
>
> No.
> Below script works fine with both bioruby-1.2.1 and CVS HEAD.
> #---------------------------------------------------
>  require 'bio'
>
>  seq = Bio::Sequence::NA.new(
>    "atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg
>     gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc
>     gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag
>     gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg
>     gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag
>     aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg
>     cccacctttggcaagaagaagggccccaatgccaactcttaa")
>
>  p "-m 7"
>
>  remote = Bio::Blast.remote('blastn', 'genes-nt', '-e 0.01')
>  blobj = remote.query(seq)
>  blobj.each_hit do |hit|
>    puts "#{hit.target_def} #{hit.evalue}"
>  end
>
>  p "-m 8"
>
>  remote8 = Bio::Blast.remote('blastn', 'genes-nt', '-m 8 -e 0.01')
>  blobj = remote8.query(seq)
>  blobj.each_hit do |hit|
>    puts "#{hit.target_def} #{hit.evalue}"
>  end
> #---------------------------------------------------
>
>> I have some code
>>
>> fasta_sequences.each do |seq_obj|
>>   blast_report = remote_blast(seq_obj.seq, 'blastn', 'nr-nt')
>>  ..........
>> end
>>
>> this calls the method
>>
>> def remote_blast(seq_obj, program, db = 'nr-nt', options = '', server
>> = 'genomenet')
>>   # create BLAST factory object
>>   factory = Bio::Blast.remote(program, db, '-m 8' + options, server)
>>   report = factory.query(seq_obj)
>> end
>>
>> This fails to return anything - just times out
>
> BLAST search with database 'nr-nt' usually takes very very long time.
> In Bio::Blast#exec_genomenet method, timeout is extended to 600 sec,
> but if the calculation time is longer, timeout error will happen.
>
> The timeout can be shorter than above value depend on your network,
> because administrators of your network can limit maximum timeout
> value in their router and/or proxy.
>
>> If I include the -V option to limit the number of hits returned
>>
>>   blast_report = remote_blast(seq_obj.seq, 'blastn', 'nr-nt', "-V  
>> 10")
>
> '-V' option in blastall means:
> |  -V  Force use of the legacy BLAST engine [T/F]  Optional
> |    default = F"
> (taken from blatall help message)
>
> '-v' and '-b' can be used. Be careful they are case sensitive.
> |  -v  Number of database sequences to show one-line descriptions  
> for (V) [Integer]
> |    default = 500
> |  -b  Number of database sequence to show alignments for (B)  
> [Integer]
> |    default = 250
>
> In addition, using '-e' option to limit e-value is better,
> because default e-value (10.0) is generally too big.
>
>> I get no hits , or a message "RuntimeError: cannot understand
>> response" which I think is due to the "holding page" that occurs when
>> a job is running
>
> Perhaps because unrecognized option was specified.
>
>> Does anybody know  a fix for this? Should I start to try and get a
>> ncbi remote blast working. Is there anybody who would like to help
>> with this?
>>
>> Thanks
>>
>> Anthony
>> _______________________________________________
>> BioRuby mailing list
>> BioRuby at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioruby
>
>
> Naohisa Goto
> ngoto at gen-info.osaka-u.ac.jp / ng at bioruby.org
>
> _______________________________________________
> BioRuby mailing list
> BioRuby at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioruby