[BioRuby-cvs] bioruby/lib/bio map.rb, 1.8, 1.9 location.rb, 0.26, 0.27

Katayama Toshiaki k at dev.open-bio.org
Sun Dec 24 05:10:10 EST 2006


Update of /home/repository/bioruby/bioruby/lib/bio
In directory dev.open-bio.org:/tmp/cvs-serv1876/lib/bio

Modified Files:
	map.rb location.rb 
Log Message:
* Bio::Locations#equals? method is moved from bio/map.rb to bio/location.rb
* RDoc documents are reformatted to fit within 80 columns on terminal


Index: location.rb
===================================================================
RCS file: /home/repository/bioruby/bioruby/lib/bio/location.rb,v
retrieving revision 0.26
retrieving revision 0.27
diff -C2 -d -r0.26 -r0.27
*** location.rb	19 Sep 2006 06:13:54 -0000	0.26
--- location.rb	24 Dec 2006 10:10:08 -0000	0.27
***************
*** 3,7 ****
  #
  # Copyright::	Copyright (C) 2001, 2005 Toshiaki Katayama <k at bioruby.org>
! #                             2006 Jan Aerts <jan.aerts at bbsrc.ac.uk>
  # License::	Ruby's
  #
--- 3,7 ----
  #
  # Copyright::	Copyright (C) 2001, 2005 Toshiaki Katayama <k at bioruby.org>
! # Copyright::   Copyright (C) 2006 Jan Aerts <jan.aerts at bbsrc.ac.uk>
  # License::	Ruby's
  #
***************
*** 13,19 ****
  # == Description
  #
! # The Bio::Location class describes the position of a genomic locus. Typically,
! # Bio::Location objects are created automatically when the user creates a
! # Bio::Locations object, instead of initialized directly.
  #
  # == Usage
--- 13,19 ----
  # == Description
  #
! # The Bio::Location class describes the position of a genomic locus.
! # Typically, Bio::Location objects are created automatically when the
! # user creates a Bio::Locations object, instead of initialized directly.
  #
  # == Usage
***************
*** 29,42 ****
  #
  class Location
    include Comparable
  	
    # Parses a'location' segment, which can be 'ID:' + ('n' or 'n..m' or 'n^m'
    # or "seq") with '<' or '>', and returns a Bio::Location object.
    #   location = Bio::Location.new('500..550')
    # 
    # ---
    # *Arguments*:
!   # * (required) _str_: GenBank style position string (see Bio::Locations documentation)
!   # *Returns*:: Bio::Location object
    def initialize(location = nil)
  
--- 29,45 ----
  #
  class Location
+ 
    include Comparable
  	
    # Parses a'location' segment, which can be 'ID:' + ('n' or 'n..m' or 'n^m'
    # or "seq") with '<' or '>', and returns a Bio::Location object.
+   #
    #   location = Bio::Location.new('500..550')
    # 
    # ---
    # *Arguments*:
!   # * (required) _str_: GenBank style position string (see Bio::Locations
!   #   documentation)
!   # *Returns*:: the Bio::Location object
    def initialize(location = nil)
  
***************
*** 55,59 ****
      # s : start base, e : end base => from, to
      case location
!     when /^[<>]?(\d+)$/				# (A, I) n
        s = e = $1.to_i
      when /^[<>]?(\d+)\.\.[<>]?(\d+)$/			# (B, I) n..m
--- 58,62 ----
      # s : start base, e : end base => from, to
      case location
!     when /^[<>]?(\d+)$/					# (A, I) n
        s = e = $1.to_i
      when /^[<>]?(\d+)\.\.[<>]?(\d+)$/			# (B, I) n..m
***************
*** 103,107 ****
    # ---
    # *Arguments*:
!   # * (required) _sequence_: sequence to be used to replace the sequence at the location
    # *Returns*:: the Bio::Location object
    def replace(sequence)
--- 106,111 ----
    # ---
    # *Arguments*:
!   # * (required) _sequence_: sequence to be used to replace the sequence
!   #   at the location
    # *Returns*:: the Bio::Location object
    def replace(sequence)
***************
*** 117,123 ****
    # Check where a Bio::Location object is located compared to another
    # Bio::Location object (mainly to facilitate the use of Comparable).
!   # A location A is upstream of location B if the start position of location A
!   # is smaller than the start position of location B. If they're the same, the
!   # end positions are checked.
    # ---
    # *Arguments*:
--- 121,127 ----
    # Check where a Bio::Location object is located compared to another
    # Bio::Location object (mainly to facilitate the use of Comparable).
!   # A location A is upstream of location B if the start position of
!   # location A is smaller than the start position of location B. If
!   # they're the same, the end positions are checked.
    # ---
    # *Arguments*:
***************
*** 147,151 ****
    end
  
! end # class location
  
  # == Description
--- 151,155 ----
    end
  
! end # Location
  
  # == Description
***************
*** 158,171 ****
  #
  #   locations = Bio::Locations.new('join(complement(500..550), 600..625)')
! #   locations.each do |location|
! #     puts "class=" + location.class.to_s
! #     puts "start=" + location.from.to_s + ";end=" + location.to.to_s \
! #          + ";strand=" + location.strand.to_s
  #   end
! #     # Output would be:
! #     # class=Bio::Location
! #     # start=500;end=550;strand=-1
! #     # class=Bio::Location
! #     # start=600;end=625;strand=1
  # 
  #  # For the following three location strings, print the span and range
--- 162,174 ----
  #
  #   locations = Bio::Locations.new('join(complement(500..550), 600..625)')
! #   locations.each do |loc|
! #     puts "class = " + loc.class.to_s
! #     puts "range = #{loc.from}..#{loc.to} (strand = #{loc.strand})"
  #   end
! #   # Output would be:
! #   #   class = Bio::Location
! #   #   range = 500..550 (strand = -1)
! #   #   class = Bio::Location
! #   #   range = 600..625 (strand = 1)
  # 
  #  # For the following three location strings, print the span and range
***************
*** 178,229 ****
  #  end
  #
! # == GenBank location descriptor classification
  # 
! # === Definition of the position notation of the GenBank location format
  # 
  # According to the GenBank manual 'gbrel.txt', position notations were
  # classified into 10 patterns - (A) to (J).
  # 
! #       3.4.12.2 Feature Location
! #       
! #         The second column of the feature descriptor line designates the
! #       location of the feature in the sequence. The location descriptor
! #       begins at position 22. Several conventions are used to indicate
! #       sequence location.
! #       
! #         Base numbers in location descriptors refer to numbering in the entry,
! #       which is not necessarily the same as the numbering scheme used in the
! #       published report. The first base in the presented sequence is numbered
! #       base 1. Sequences are presented in the 5 to 3 direction.
! #       
! #       Location descriptors can be one of the following:
  #       
  #   (A) 1. A single base;
! #       
  #   (B) 2. A contiguous span of bases;
! #       
  #   (C) 3. A site between two bases;
! #       
  #   (D) 4. A single base chosen from a range of bases;
! #   
  #   (E) 5. A single base chosen from among two or more specified bases;
! #   
  #   (F) 6. A joining of sequence spans;
! #   
  #   (G) 7. A reference to an entry other than the one to which the feature
! #         belongs (i.e., a remote entry), followed by a location descriptor
! #         referring to the remote sequence;
! #   
  #   (H) 8. A literal sequence (a string of bases enclosed in quotation marks).
  #   
! #   
  #   (C)   A site between two residues, such as an endonuclease cleavage site, is
  #       indicated by listing the two bases separated by a carat (e.g., 23^24).
! #   
  #   (D)   A single residue chosen from a range of residues is indicated by the
  #       number of the first and last bases in the range separated by a single
  #       period (e.g., 23.79). The symbols < and > indicate that the end point
  #   (I) of the range is beyond the specified base number.
! #   
  #   (B)   A contiguous span of bases is indicated by the number of the first and
  #       last bases in the range separated by two periods (e.g., 23..79). The
--- 181,233 ----
  #  end
  #
! # === GenBank location descriptor classification
  # 
! # ==== Definition of the position notation of the GenBank location format
  # 
  # According to the GenBank manual 'gbrel.txt', position notations were
  # classified into 10 patterns - (A) to (J).
  # 
! #   3.4.12.2 Feature Location
! #   
! #     The second column of the feature descriptor line designates the
! #   location of the feature in the sequence. The location descriptor
! #   begins at position 22. Several conventions are used to indicate
! #   sequence location.
! #   
! #     Base numbers in location descriptors refer to numbering in the entry,
! #   which is not necessarily the same as the numbering scheme used in the
! #   published report. The first base in the presented sequence is numbered
! #   base 1. Sequences are presented in the 5 to 3 direction.
! #   
! #   Location descriptors can be one of the following:
  #       
  #   (A) 1. A single base;
! #         
  #   (B) 2. A contiguous span of bases;
! #         
  #   (C) 3. A site between two bases;
! #         
  #   (D) 4. A single base chosen from a range of bases;
! #     
  #   (E) 5. A single base chosen from among two or more specified bases;
! #     
  #   (F) 6. A joining of sequence spans;
! #     
  #   (G) 7. A reference to an entry other than the one to which the feature
! #        belongs (i.e., a remote entry), followed by a location descriptor
! #        referring to the remote sequence;
! #     
  #   (H) 8. A literal sequence (a string of bases enclosed in quotation marks).
  #   
! # ==== Description commented with pattern IDs.
! #  
  #   (C)   A site between two residues, such as an endonuclease cleavage site, is
  #       indicated by listing the two bases separated by a carat (e.g., 23^24).
! #     
  #   (D)   A single residue chosen from a range of residues is indicated by the
  #       number of the first and last bases in the range separated by a single
  #       period (e.g., 23.79). The symbols < and > indicate that the end point
  #   (I) of the range is beyond the specified base number.
! # 
  #   (B)   A contiguous span of bases is indicated by the number of the first and
  #       last bases in the range separated by two periods (e.g., 23..79). The
***************
*** 231,254 ****
  #       specified base number. Starting and ending positions can be indicated
  #       by base number or by one of the operators described below.
! #   
  #         Operators are prefixes that specify what must be done to the indicated
  #       sequence to locate the feature. The following are the operators
  #       available, along with their most common format and a description.
! #   
  #   (J) complement (location): The feature is complementary to the location
  #       indicated. Complementary strands are read 5 to 3.
! #   
  #   (F) join (location, location, .. location): The indicated elements should
  #       be placed end to end to form one contiguous sequence.
! #   
  #   (F) order (location, location, .. location): The elements are found in the
  #       specified order in the 5 to 3 direction, but nothing is implied about
  #       the rationality of joining them.
! #   
  #   (F) group (location, location, .. location): The elements are related and
  #       should be grouped together, but no order is implied.
! #   
  #   (E) one-of (location, location, .. location): The element can be any one,
! #       but only one, of the items listed.
  # 
  # === Reduction strategy of the position notations
--- 235,258 ----
  #       specified base number. Starting and ending positions can be indicated
  #       by base number or by one of the operators described below.
! # 
  #         Operators are prefixes that specify what must be done to the indicated
  #       sequence to locate the feature. The following are the operators
  #       available, along with their most common format and a description.
! # 
  #   (J) complement (location): The feature is complementary to the location
  #       indicated. Complementary strands are read 5 to 3.
! # 
  #   (F) join (location, location, .. location): The indicated elements should
  #       be placed end to end to form one contiguous sequence.
! # 
  #   (F) order (location, location, .. location): The elements are found in the
  #       specified order in the 5 to 3 direction, but nothing is implied about
  #       the rationality of joining them.
! # 
  #   (F) group (location, location, .. location): The elements are related and
  #       should be grouped together, but no order is implied.
! # 
  #   (E) one-of (location, location, .. location): The element can be any one,
! #     but only one, of the items listed.
  # 
  # === Reduction strategy of the position notations
***************
*** 257,404 ****
  # * (B) Location n..m
  # * (C) Location n^m
! # * (D) (n.m)		=> Location n
  # * (E)
! #   * one-of(n,m,..)	=> Location n
! #   * one-of(n..m,..)	=> Location n..m
  # * (F)
! #   * order(loc,loc,..)	=> join(loc, loc,..)
! #   * group(loc,loc,..)	=> join(loc, loc,..)
! #   * join(loc,loc,..)	=> Sequence
! # * (G) ID:loc		=> Location with ID
! # * (H) "atgc"		=> Location only with Sequence
  # * (I)
  #   * <n			=> Location n with lt flag
  #   * >n			=> Location n with gt flag
! #   * <n..m		=> Location n..m with lt flag
! #   * n..>m		=> Location n..m with gt flag
! #   * <n..>m		=> Location n..m with lt, gt flag
! # * (J) complement(loc)	=> Sequence
  # * (K) replace(loc, str)	=> Location with replacement Sequence
  # 
- # === GenBank location examples
- # 
- # (C) n^m
- # 
- # * [AB015179]	754^755
- # * [AF179299]	complement(53^54)
- # * [CELXOL1ES]	replace(4480^4481,"")
- # * [ECOUW87]	replace(4792^4793,"a")
- # * [APLPCII]	replace(1905^1906,"acaaagacaccgccctacgcc")
- # 
- # (D) (n.m)
- # 
- # * [HACSODA]	157..(800.806)
- # * [HALSODB]	(67.68)..(699.703)
- # * [AP001918]	(45934.45974)..46135
- # * [BACSPOJ]	<180..(731.761)
- # * [BBU17998]	(88.89)..>1122
- # * [ECHTGA]	complement((1700.1708)..(1715.1721))
- # * [ECPAP17]	complement(<22..(255.275))
- # * [LPATOVGNS]	complement((64.74)..1525)
- # * [PIP404CG]	join((8298.8300)..10206,1..855)
- # * [BOVMHDQBY4]	join(M30006.1:(392.467)..575,M30005.1:415..681,M30004.1:129..410,M30004.1:907..1017,521..534)
- # * [HUMMIC2A]	replace((651.655)..(651.655),"")
- # * [HUMSOD102]	order(L44135.1:(454.445)..>538,<1..181)
- # 
- # (E) one-of
- # 
- # * [ECU17136]	one-of(898,900)..983
- # * [CELCYT1A]	one-of(5971..6308,5971..6309)
- # * [DMU17742]	8050..one-of(10731,10758,10905,11242)
- # * [PFU27807]	one-of(623,627,632)..one-of(628,633,637)
- # * [BTBAINH1]	one-of(845,953,963,1078,1104)..1354
- # * [ATU39449]	join(one-of(969..1094,970..1094,995..1094,1018..1094),1518..1587,1726..2119,2220..2833,2945..3215)
- # 
- # (F) join, order, group
- # 
- # * [AB037374S2]	join(AB037374.1:1..177,1..807)
- # * [AP000001]	join(complement(1..61),complement(AP000007.1:252907..253505))
- # * [ASNOS11]	join(AF130124.1:<2563..2964,AF130125.1:21..157,AF130126.1:12..174,AF130127.1:21..112,AF130128.1:21..162,AF130128.1:281..595,AF130128.1:661..842,AF130128.1:916..1030,AF130129.1:21..115,AF130130.1:21..165,AF130131.1:21..125,AF130132.1:21..428,AF130132.1:492..746,AF130133.1:21..168,AF130133.1:232..401,AF130133.1:475..906,AF130133.1:970..1107,AF130133.1:1176..1367,21..>128)
- # 
- # * [AARPOB2]	order(AF194507.1:<1..510,1..>871)
- # * [AF006691]	order(912..1918,20410..21416)
- # * [AF024666]	order(complement(18919..19224),complement(13965..14892))
- # * [AF264948]	order(27066..27076,27089..27099,27283..27314,27330..27352)
- # * [D63363]	order(3..26,complement(964..987))
- # * [ECOCURLI2]	order(complement(1009..>1260),complement(AF081827.1:<1..177))
- # * [S72388S2]	order(join(S72388.1:757..911,S72388.1:609..1542),1..>139)
- # * [HEYRRE07]	order(complement(1..38),complement(M82666.1:1..140),complement(M82665.1:1..176),complement(M82664.1:1..215),complement(M82663.1:1..185),complement(M82662.1:1..49),complement(M82661.1:1..133))
- # * [COL11A1G34]	order(AF101079.1:558..1307,AF101080.1:1..749,AF101081.1:1..898,AF101082.1:1..486,AF101083.1:1..942,AF101084.1:1..1734,AF101085.1:1..2385,AF101086.1:1..1813,AF101087.1:1..2287,AF101088.1:1..1073,AF101089.1:1..989,AF101090.1:1..5017,AF101091.1:1..3401,AF101092.1:1..1225,AF101093.1:1..1072,AF101094.1:1..989,AF101095.1:1..1669,AF101096.1:1..918,AF101097.1:1..1114,AF101098.1:1..1074,AF101099.1:1..1709,AF101100.1:1..986,AF101101.1:1..1934,AF101102.1:1..1699,AF101103.1:1..940,AF101104.1:1..2330,AF101105.1:1..4467,AF101106.1:1..1876,AF101107.1:1..2465,AF101108.1:1..1150,AF101109.1:1..1170,AF101110.1:1..1158,AF101111.1:1..1193,1..611)
- # 
- # group() are found in the COMMENT field only (in GenBank 122.0)
- # 
- #   gbpat2.seq:            FT   repeat_region   group(598..606,611..619)
- #   gbpat2.seq:            FT   repeat_region   group(8..16,1457..1464).
- #   gbpat2.seq:            FT   variation       group(t1,t2)
- #   gbpat2.seq:            FT   variation       group(t1,t3)
- #   gbpat2.seq:            FT   variation       group(t1,t2,t3)
- #   gbpat2.seq:            FT   repeat_region   group(11..202,203..394)
- #   gbpri9.seq:COMMENT     Residues reported = 'group(1..2145);'.
- # 
- # (G) ID:location
- # 
- # * [AARPOB2]	order(AF194507.1:<1..510,1..>871)
- # * [AF178221S4]	join(AF178221.1:<1..60,AF178222.1:1..63,AF178223.1:1..42,1..>90)
- # * [BOVMHDQBY4]	join(M30006.1:(392.467)..575,M30005.1:415..681,M30004.1:129..410,M30004.1:907..1017,521..534)
- # * [HUMSOD102]	order(L44135.1:(454.445)..>538,<1..181)
- # * [SL16SRRN1]	order(<1..>267,X67092.1:<1..>249,X67093.1:<1..>233)
- # 
- # (I) <, >
- # 
- # * [A5U48871]	<1..>318
- # * [AA23SRRNP]	<1..388
- # * [AA23SRRNP]	503..>1010
- # * [AAM5961]	complement(<1..229)
- # * [AAM5961]	complement(5231..>5598)
- # * [AF043934]	join(<1,60..99,161..241,302..370,436..594,676..887,993..1141,1209..1329,1387..1559,1626..1646,1708..>1843)
- # * [BACSPOJ]	<180..(731.761)
- # * [BBU17998]	(88.89)..>1122
- # * [AARPOB2]	order(AF194507.1:<1..510,1..>871)
- # * [SL16SRRN1]	order(<1..>267,X67092.1:<1..>249,X67093.1:<1..>233)
- # 
- # (J) complement
- # 
- # * [AF179299]	complement(53^54)	<= hoge insertion site etc.
- # * [AP000001]	join(complement(1..61),complement(AP000007.1:252907..253505))
- # * [AF209868S2]	order(complement(1..>308),complement(AF209868.1:75..336))
- # * [AP000001]	join(complement(1..61),complement(AP000007.1:252907..253505))
- # * [CPPLCG]	complement(<1..(1093.1098))
- # * [D63363]	order(3..26,complement(964..987))
- # * [ECHTGA]	complement((1700.1708)..(1715.1721))
- # * [ECOUXW]	order(complement(1658..1663),complement(1636..1641))
- # * [LPATOVGNS]	complement((64.74)..1525)
- # * [AF129075]	complement(join(71606..71829,75327..75446,76039..76203,76282..76353,76914..77029,77114..77201,77276..77342,78138..78316,79755..79892,81501..81562,81676..81856,82341..82490,84208..84287,85032..85122,88316..88403))
- # * [ZFDYST2]	join(AF137145.1:<1..18,complement(<1..99))
- # 
- # (K) replace
- # 
- # * [CSU27710]	replace(64,"A")
- # * [CELXOL1ES]	replace(5256,"t")
- # * [ANICPC]	replace(1..468,"")
- # * [CSU27710]	replace(67..68,"GC")
- # * [CELXOL1ES]	replace(4480^4481,"")	<= ? only one case in GenBank 122.0
- # * [ECOUW87]	replace(4792^4793,"a")
- # * [CEU34893]	replace(1..22,"ggttttaacccagttactcaag")
- # * [APLPCII]	replace(1905^1906,"acaaagacaccgccctacgcc")
- # * [MBDR3S1]	replace(1400..>9281,"")
- # * [HUMMHDPB1F]	replace(complement(36..37),"ttc")
- # * [HUMMIC2A]	replace((651.655)..(651.655),"")
- # * [LEIMDRPGP]	replace(1..1554,"L01572")
- # * [TRBND3]	replace(376..395,"atttgtgtgtggtaatta")
- # * [TRBND3]	replace(376..395,"atttgtgtgggtaatttta")
- # * [TRBND3]	replace(376..395,"attttgttgttgttttgttttgaatta")
- # * [TRBND3]	replace(376..395,"atgtgtggtgaatta")
- # * [TRBND3]	replace(376..395,"atgtgtgtggtaatta")
- # * [TRBND3]	replace(376..395,"gatttgttgtggtaatttta")
- # * [MSU09460]	replace(193,		<= replace(193, "t")
- # * [HUMMAGE12X]	replace(3002..3003,	<= replace(3002..3003, "GC")
- # * [ADR40FIB]	replace(510..520,	<= replace(510..520, "taatcctaccg")
- # * [RATDYIIAAB]	replace(1306..1443,"aagaacatccacggagtcagaactgggctcttcacgccggatttggcgttcgaggccattgtgaaaaagcaggcaatgcaccagcaagctcagttcctacccctgcgtggacctggttatccaggagctaatcagtacagttaggtggtcaagctgaaagagccctgtctgaaa")
- #
  class Locations
    include Enumerable
  
!   # Parses a GenBank style position string and returns a Bio::Locations object,
!   # which contains a list of Bio::Location objects.
    #   locations = Bio::Locations.new('join(complement(500..550), 600..625)')
    #
--- 261,290 ----
  # * (B) Location n..m
  # * (C) Location n^m
! # * (D) (n.m)			=> Location n
  # * (E)
! #   * one-of(n,m,..)		=> Location n
! #   * one-of(n..m,..)		=> Location n..m
  # * (F)
! #   * order(loc,loc,..)		=> join(loc, loc,..)
! #   * group(loc,loc,..)		=> join(loc, loc,..)
! #   * join(loc,loc,..)		=> Sequence
! # * (G) ID:loc			=> Location with ID
! # * (H) "atgc"			=> Location only with Sequence
  # * (I)
  #   * <n			=> Location n with lt flag
  #   * >n			=> Location n with gt flag
! #   * <n..m			=> Location n..m with lt flag
! #   * n..>m			=> Location n..m with gt flag
! #   * <n..>m			=> Location n..m with lt, gt flag
! # * (J) complement(loc)		=> Sequence
  # * (K) replace(loc, str)	=> Location with replacement Sequence
  # 
  class Locations
+ 
    include Enumerable
  
!   # Parses a GenBank style position string and returns a Bio::Locations
!   # object, which contains a list of Bio::Location objects.
!   #
    #   locations = Bio::Locations.new('join(complement(500..550), 600..625)')
    #
***************
*** 419,422 ****
--- 305,320 ----
    attr_accessor :locations
  
+   # Evaluate equality of Bio::Locations object.
+   def equals?(other)
+     if ! other.kind_of?(Bio::Locations)
+       return nil
+     end
+     if self.sort == other.sort
+       return true
+     else
+       return false
+     end
+   end
+ 
    # Iterates on each Bio::Location object.
    def each
***************
*** 479,482 ****
--- 377,381 ----
    #   puts loc.relative(13524)        # => 10
    #   puts loc.relative(13506, :aa)   # => 3
+   #
    # ---
    # *Arguments*:
***************
*** 509,516 ****
    #   puts loc.absolute(10)          # => 13524
    #   puts loc.absolute(10, :aa)     # => 13506
    # ---
    # *Arguments*:
    # * (required) _position_: nucleotide position within locus
!   # * _:aa_: flag to be used if _position_ is a aminoacid position rather than a nucleotide position
    # *Returns*:: position within the whole of the sequence
    def absolute(n, type = nil)
--- 408,417 ----
    #   puts loc.absolute(10)          # => 13524
    #   puts loc.absolute(10, :aa)     # => 13506
+   #
    # ---
    # *Arguments*:
    # * (required) _position_: nucleotide position within locus
!   # * _:aa_: flag to be used if _position_ is a aminoacid position rather than
!   #   a nucleotide position
    # *Returns*:: position within the whole of the sequence
    def absolute(n, type = nil)
***************
*** 540,546 ****
      position.gsub!(/(\.{2})?\(?([<>\d]+)\.([<>\d]+)(?!:)\)?/) do |match|
        if $1
!         $1 + $3			# ..(n.m)  => ..m
        else
!         $2				# (?n.m)?  => n
        end
      end
--- 441,447 ----
      position.gsub!(/(\.{2})?\(?([<>\d]+)\.([<>\d]+)(?!:)\)?/) do |match|
        if $1
!         $1 + $3						# ..(n.m)  => ..m
        else
!         $2						# (?n.m)?  => n
        end
      end
***************
*** 550,556 ****
      position.gsub!(/(\.{2})?one-of\(([^,]+),([^)]+)\)/) do |match|
        if $1
!         $1 + $3.gsub(/.*,(.*)/, '\1')	# ..one-of(n,m)  => ..m
        else
!         $2				# one-of(n,m)    => n
        end
      end
--- 451,457 ----
      position.gsub!(/(\.{2})?one-of\(([^,]+),([^)]+)\)/) do |match|
        if $1
!         $1 + $3.gsub(/.*,(.*)/, '\1')			# ..one-of(n,m)  => ..m
        else
!         $2						# one-of(n,m)    => n
        end
      end
***************
*** 670,678 ****
    end
  
! end # class Locations
  
! end # module Bio
  
  
  if __FILE__ == $0
    puts "Test new & span methods"
--- 571,701 ----
    end
  
! end # Locations
  
! end # Bio
  
  
+ 
+ # === GenBank location examples
+ # 
+ # (C) n^m
+ # 
+ # * [AB015179]	754^755
+ # * [AF179299]	complement(53^54)
+ # * [CELXOL1ES]	replace(4480^4481,"")
+ # * [ECOUW87]	replace(4792^4793,"a")
+ # * [APLPCII]	replace(1905^1906,"acaaagacaccgccctacgcc")
+ # 
+ # (D) (n.m)
+ # 
+ # * [HACSODA]	157..(800.806)
+ # * [HALSODB]	(67.68)..(699.703)
+ # * [AP001918]	(45934.45974)..46135
+ # * [BACSPOJ]	<180..(731.761)
+ # * [BBU17998]	(88.89)..>1122
+ # * [ECHTGA]	complement((1700.1708)..(1715.1721))
+ # * [ECPAP17]	complement(<22..(255.275))
+ # * [LPATOVGNS]	complement((64.74)..1525)
+ # * [PIP404CG]	join((8298.8300)..10206,1..855)
+ # * [BOVMHDQBY4]	join(M30006.1:(392.467)..575,M30005.1:415..681,M30004.1:129..410,M30004.1:907..1017,521..534)
+ # * [HUMMIC2A]	replace((651.655)..(651.655),"")
+ # * [HUMSOD102]	order(L44135.1:(454.445)..>538,<1..181)
+ # 
+ # (E) one-of
+ # 
+ # * [ECU17136]	one-of(898,900)..983
+ # * [CELCYT1A]	one-of(5971..6308,5971..6309)
+ # * [DMU17742]	8050..one-of(10731,10758,10905,11242)
+ # * [PFU27807]	one-of(623,627,632)..one-of(628,633,637)
+ # * [BTBAINH1]	one-of(845,953,963,1078,1104)..1354
+ # * [ATU39449]	join(one-of(969..1094,970..1094,995..1094,1018..1094),1518..1587,1726..2119,2220..2833,2945..3215)
+ # 
+ # (F) join, order, group
+ # 
+ # * [AB037374S2]	join(AB037374.1:1..177,1..807)
+ # * [AP000001]	join(complement(1..61),complement(AP000007.1:252907..253505))
+ # * [ASNOS11]	join(AF130124.1:<2563..2964,AF130125.1:21..157,AF130126.1:12..174,AF130127.1:21..112,AF130128.1:21..162,AF130128.1:281..595,AF130128.1:661..842,AF130128.1:916..1030,AF130129.1:21..115,AF130130.1:21..165,AF130131.1:21..125,AF130132.1:21..428,AF130132.1:492..746,AF130133.1:21..168,AF130133.1:232..401,AF130133.1:475..906,AF130133.1:970..1107,AF130133.1:1176..1367,21..>128)
+ # 
+ # * [AARPOB2]	order(AF194507.1:<1..510,1..>871)
+ # * [AF006691]	order(912..1918,20410..21416)
+ # * [AF024666]	order(complement(18919..19224),complement(13965..14892))
+ # * [AF264948]	order(27066..27076,27089..27099,27283..27314,27330..27352)
+ # * [D63363]	order(3..26,complement(964..987))
+ # * [ECOCURLI2]	order(complement(1009..>1260),complement(AF081827.1:<1..177))
+ # * [S72388S2]	order(join(S72388.1:757..911,S72388.1:609..1542),1..>139)
+ # * [HEYRRE07]	order(complement(1..38),complement(M82666.1:1..140),complement(M82665.1:1..176),complement(M82664.1:1..215),complement(M82663.1:1..185),complement(M82662.1:1..49),complement(M82661.1:1..133))
+ # * [COL11A1G34]	order(AF101079.1:558..1307,AF101080.1:1..749,AF101081.1:1..898,AF101082.1:1..486,AF101083.1:1..942,AF101084.1:1..1734,AF101085.1:1..2385,AF101086.1:1..1813,AF101087.1:1..2287,AF101088.1:1..1073,AF101089.1:1..989,AF101090.1:1..5017,AF101091.1:1..3401,AF101092.1:1..1225,AF101093.1:1..1072,AF101094.1:1..989,AF101095.1:1..1669,AF101096.1:1..918,AF101097.1:1..1114,AF101098.1:1..1074,AF101099.1:1..1709,AF101100.1:1..986,AF101101.1:1..1934,AF101102.1:1..1699,AF101103.1:1..940,AF101104.1:1..2330,AF101105.1:1..4467,AF101106.1:1..1876,AF101107.1:1..2465,AF101108.1:1..1150,AF101109.1:1..1170,AF101110.1:1..1158,AF101111.1:1..1193,1..611)
+ # 
+ # group() are found in the COMMENT field only (in GenBank 122.0)
+ # 
+ #   gbpat2.seq:            FT   repeat_region   group(598..606,611..619)
+ #   gbpat2.seq:            FT   repeat_region   group(8..16,1457..1464).
+ #   gbpat2.seq:            FT   variation       group(t1,t2)
+ #   gbpat2.seq:            FT   variation       group(t1,t3)
+ #   gbpat2.seq:            FT   variation       group(t1,t2,t3)
+ #   gbpat2.seq:            FT   repeat_region   group(11..202,203..394)
+ #   gbpri9.seq:COMMENT     Residues reported = 'group(1..2145);'.
+ # 
+ # (G) ID:location
+ # 
+ # * [AARPOB2]	order(AF194507.1:<1..510,1..>871)
+ # * [AF178221S4]	join(AF178221.1:<1..60,AF178222.1:1..63,AF178223.1:1..42,1..>90)
+ # * [BOVMHDQBY4]	join(M30006.1:(392.467)..575,M30005.1:415..681,M30004.1:129..410,M30004.1:907..1017,521..534)
+ # * [HUMSOD102]	order(L44135.1:(454.445)..>538,<1..181)
+ # * [SL16SRRN1]	order(<1..>267,X67092.1:<1..>249,X67093.1:<1..>233)
+ # 
+ # (I) <, >
+ # 
+ # * [A5U48871]	<1..>318
+ # * [AA23SRRNP]	<1..388
+ # * [AA23SRRNP]	503..>1010
+ # * [AAM5961]	complement(<1..229)
+ # * [AAM5961]	complement(5231..>5598)
+ # * [AF043934]	join(<1,60..99,161..241,302..370,436..594,676..887,993..1141,1209..1329,1387..1559,1626..1646,1708..>1843)
+ # * [BACSPOJ]	<180..(731.761)
+ # * [BBU17998]	(88.89)..>1122
+ # * [AARPOB2]	order(AF194507.1:<1..510,1..>871)
+ # * [SL16SRRN1]	order(<1..>267,X67092.1:<1..>249,X67093.1:<1..>233)
+ # 
+ # (J) complement
+ # 
+ # * [AF179299]	complement(53^54)	<= hoge insertion site etc.
+ # * [AP000001]	join(complement(1..61),complement(AP000007.1:252907..253505))
+ # * [AF209868S2]	order(complement(1..>308),complement(AF209868.1:75..336))
+ # * [AP000001]	join(complement(1..61),complement(AP000007.1:252907..253505))
+ # * [CPPLCG]	complement(<1..(1093.1098))
+ # * [D63363]	order(3..26,complement(964..987))
+ # * [ECHTGA]	complement((1700.1708)..(1715.1721))
+ # * [ECOUXW]	order(complement(1658..1663),complement(1636..1641))
+ # * [LPATOVGNS]	complement((64.74)..1525)
+ # * [AF129075]	complement(join(71606..71829,75327..75446,76039..76203,76282..76353,76914..77029,77114..77201,77276..77342,78138..78316,79755..79892,81501..81562,81676..81856,82341..82490,84208..84287,85032..85122,88316..88403))
+ # * [ZFDYST2]	join(AF137145.1:<1..18,complement(<1..99))
+ # 
+ # (K) replace
+ # 
+ # * [CSU27710]	replace(64,"A")
+ # * [CELXOL1ES]	replace(5256,"t")
+ # * [ANICPC]	replace(1..468,"")
+ # * [CSU27710]	replace(67..68,"GC")
+ # * [CELXOL1ES]	replace(4480^4481,"")	<= ? only one case in GenBank 122.0
+ # * [ECOUW87]	replace(4792^4793,"a")
+ # * [CEU34893]	replace(1..22,"ggttttaacccagttactcaag")
+ # * [APLPCII]	replace(1905^1906,"acaaagacaccgccctacgcc")
+ # * [MBDR3S1]	replace(1400..>9281,"")
+ # * [HUMMHDPB1F]	replace(complement(36..37),"ttc")
+ # * [HUMMIC2A]	replace((651.655)..(651.655),"")
+ # * [LEIMDRPGP]	replace(1..1554,"L01572")
+ # * [TRBND3]	replace(376..395,"atttgtgtgtggtaatta")
+ # * [TRBND3]	replace(376..395,"atttgtgtgggtaatttta")
+ # * [TRBND3]	replace(376..395,"attttgttgttgttttgttttgaatta")
+ # * [TRBND3]	replace(376..395,"atgtgtggtgaatta")
+ # * [TRBND3]	replace(376..395,"atgtgtgtggtaatta")
+ # * [TRBND3]	replace(376..395,"gatttgttgtggtaatttta")
+ # * [MSU09460]	replace(193,		<= replace(193, "t")
+ # * [HUMMAGE12X]	replace(3002..3003,	<= replace(3002..3003, "GC")
+ # * [ADR40FIB]	replace(510..520,	<= replace(510..520, "taatcctaccg")
+ # * [RATDYIIAAB]	replace(1306..1443,"aagaacatccacggagtcagaactgggctcttcacgccggatttggcgttcgaggccattgtgaaaaagcaggcaatgcaccagcaagctcagttcctacccctgcgtggacctggttatccaggagctaatcagtacagttaggtggtcaagctgaaagagccctgtctgaaa")
+ #
+ 
  if __FILE__ == $0
    puts "Test new & span methods"

Index: map.rb
===================================================================
RCS file: /home/repository/bioruby/bioruby/lib/bio/map.rb,v
retrieving revision 1.8
retrieving revision 1.9
diff -C2 -d -r1.8 -r1.9
*** map.rb	27 Jun 2006 12:40:15 -0000	1.8
--- map.rb	24 Dec 2006 10:10:08 -0000	1.9
***************
*** 2,54 ****
  # = bio/map.rb - biological mapping class
  #
! # Copyright::   Copyright (C) 2006
! #               Jan Aerts <jan.aerts at bbsrc.ac.uk>
  # Licence::     Ruby's
  #
  # $Id$
  require 'bio/location'
  
  module Bio
  
!   # Add a method to Bio::Locations class
!   class Locations
!     def equals?(other)
!       if ! other.kind_of?(Bio::Locations)
!         return nil
!       end
!       if self.sort == other.sort
!         return true
!       else
!         return false
!       end
!     end
!   end
! 
!   # = DESCRIPTION
!   # The Bio::Module contains classes that describe mapping information and can
!   # be used to contain linkage maps, radiation-hybrid maps, etc.
!   # As the same marker can be mapped to more than one map, and a single map
!   # typically contains more than one marker, the link between the markers and
!   # maps is handled by Bio::Map::Mapping objects. Therefore, to link a map to
!   # a marker, a Bio::Mapping object is added to that Bio::Map. See usage below.
    #
!   # Not only maps in the strict sense have map-like features (and similarly
!   # not only markers in the strict sense have marker-like features). For example,
!   # a microsatellite is something that can be mapped on a linkage map (and
!   # hence becomes a 'marker'), but a clone can also be mapped to a cytogenetic
!   # map. In that case, the clone acts as a marker and has marker-like properties.
!   # That same clone can also be considered a 'map' when BAC-end sequences are
!   # mapped to it. To reflect this flexibility, the modules Bio::Map::ActsLikeMap
!   # and Bio::Map::ActsLikeMarker define methods that are typical for maps and
!   # markers.
    # 
    #--
!   # In a certain sense, a biological sequence also has map- and marker-like
!   # properties: things can be mapped to it at certain locations, and the sequence
!   # itself can be mapped to something else (e.g. the BAC-end sequence example
!   # above, or a BLAST-result).
    #++
    # 
!   # = USAGE
    #  my_marker1 = Bio::Map::Marker.new('marker1')
    #  my_marker2 = Bio::Map::Marker.new('marker2')
--- 2,44 ----
  # = bio/map.rb - biological mapping class
  #
! # Copyright::   Copyright (C) 2006 Jan Aerts <jan.aerts at bbsrc.ac.uk>
  # Licence::     Ruby's
  #
  # $Id$
+ 
  require 'bio/location'
  
  module Bio
  
!   # == Description
    #
!   # The Bio::Map contains classes that describe mapping information
!   # and can be used to contain linkage maps, radiation-hybrid maps,
!   # etc.  As the same marker can be mapped to more than one map, and a
!   # single map typically contains more than one marker, the link
!   # between the markers and maps is handled by Bio::Map::Mapping
!   # objects. Therefore, to link a map to a marker, a Bio::Map::Mapping
!   # object is added to that Bio::Map. See usage below.
!   #
!   # Not only maps in the strict sense have map-like features (and
!   # similarly not only markers in the strict sense have marker-like
!   # features). For example, a microsatellite is something that can be
!   # mapped on a linkage map (and hence becomes a 'marker'), but a
!   # clone can also be mapped to a cytogenetic map. In that case, the
!   # clone acts as a marker and has marker-like properties.  That same
!   # clone can also be considered a 'map' when BAC-end sequences are
!   # mapped to it. To reflect this flexibility, the modules
!   # Bio::Map::ActsLikeMap and Bio::Map::ActsLikeMarker define methods
!   # that are typical for maps and markers.
    # 
    #--
!   # In a certain sense, a biological sequence also has map- and
!   # marker-like properties: things can be mapped to it at certain
!   # locations, and the sequence itself can be mapped to something else
!   # (e.g. the BAC-end sequence example above, or a BLAST-result).
    #++
    # 
!   # == Usage
!   #
    #  my_marker1 = Bio::Map::Marker.new('marker1')
    #  my_marker2 = Bio::Map::Marker.new('marker2')
***************
*** 62,101 ****
    #  my_marker3.add_mapping_as_marker(my_map1, '9')
    #  
!   #  puts "Does my_map1 contain marker3? => " + my_map1.contains_marker?(my_marker3).to_s
!   #  puts "Does my_map2 contain marker3? => " + my_map2.contains_marker?(my_marker3).to_s
    #  
    #  my_map1.mappings_as_map.sort.each do |mapping|
!   #    puts mapping.map.name + "\t" + mapping.marker.name + "\t" + mapping.location.from.to_s + ".." + mapping.location.to.to_s
    #  end
    #  puts my_map1.mappings_as_map.min.marker.name
    #  my_map2.mappings_as_map.each do |mapping|
!   #    puts mapping.map.name + "\t" + mapping.marker.name + "\t" + mapping.location.from.to_s + ".." + mapping.location.to.to_s
    #  end
    module Map
!   # = DESCRIPTION
!   # The Bio::Map::ActsLikeMap module contains methods that are typical for
!   # map-like things:
!   # * add markers with their locations (through Bio::Map::Mappings)
!   # * check if a given marker is mapped to it
!   # , and can be mixed into other classes (e.g. Bio::Map::SimpleMap)
!   # 
!   # Classes that include this mixin should provide an array property called mappings_as_map.
!   # For example:
!   #   class MyMapThing
!   #     include Bio::Map::ActsLikeMap
!   #     
!   #     def initialize (name)
!   #       @name = name
!   #       @mappings_as_maps = Array.new
!   #     end
!   #     attr_accessor :name, :mappings_as_map
!   #    end
      module ActsLikeMap
!       # = DESCRIPTION
        # Adds a Bio::Map::Mappings object to its array of mappings.
        # 
!       # = USAGE
        #   # suppose we have a Bio::Map::SimpleMap object called my_map
        #   my_map.add_mapping_as_map(Bio::Map::Marker.new('marker_a'), '5')
        # ---
        # *Arguments*:
--- 52,112 ----
    #  my_marker3.add_mapping_as_marker(my_map1, '9')
    #  
!   #  print "Does my_map1 contain marker3? => "
!   #  puts my_map1.contains_marker?(my_marker3).to_s
!   #  print "Does my_map2 contain marker3? => "
!   #  puts my_map2.contains_marker?(my_marker3).to_s
    #  
    #  my_map1.mappings_as_map.sort.each do |mapping|
!   #    puts [ mapping.map.name,
!   #           mapping.marker.name,
!   #           mapping.location.from.to_s,
!   #           mapping.location.to.to_s ].join("\t")
    #  end
    #  puts my_map1.mappings_as_map.min.marker.name
+   #
    #  my_map2.mappings_as_map.each do |mapping|
!   #    puts [ mapping.map.name,
!   #           mapping.marker.name,
!   #           mapping.location.from.to_s,
!   #           mapping.location.to.to_s ].join("\t")
    #  end
+   #
    module Map
! 
!     # == Description
!     #
!     # The Bio::Map::ActsLikeMap module contains methods that are typical for
!     # map-like things:
!     #
!     # * add markers with their locations (through Bio::Map::Mappings)
!     # * check if a given marker is mapped to it,
!     #   and can be mixed into other classes (e.g. Bio::Map::SimpleMap)
!     # 
!     # Classes that include this mixin should provide an array property
!     # called mappings_as_map.
!     #
!     # For example:
!     #
!     #   class MyMapThing
!     #     include Bio::Map::ActsLikeMap
!     #     
!     #     def initialize (name)
!     #       @name = name
!     #       @mappings_as_maps = Array.new
!     #     end
!     #     attr_accessor :name, :mappings_as_map
!     #    end
!     #
      module ActsLikeMap
! 
!       # == Description
!       #
        # Adds a Bio::Map::Mappings object to its array of mappings.
        # 
!       # == Usage
!       #
        #   # suppose we have a Bio::Map::SimpleMap object called my_map
        #   my_map.add_mapping_as_map(Bio::Map::Marker.new('marker_a'), '5')
+       #
        # ---
        # *Arguments*:
***************
*** 126,131 ****
          return self
        end
!       
!       # Checks whether a Bio::Map::Marker is mapped to this Bio::Map::SimpleMap.
        # ---
        # *Arguments*:
--- 137,144 ----
          return self
        end
! 
!       # Checks whether a Bio::Map::Marker is mapped to this
!       # Bio::Map::SimpleMap.
!       #
        # ---
        # *Arguments*:
***************
*** 146,160 ****
        end
        
!     end #ActsLikeMap
  
!     # = DESCRIPTION
!     # The Bio::Map::ActsLikeMarker module contains methods that are typical for
!     # marker-like things:
      # * map it to one or more maps
      # * check if it's mapped to a given map
!     # , and can be mixed into other classes (e.g. Bio::Map::Marker)
      # 
!     # Classes that include this mixin should provide an array property called mappings_as_marker.
      # For example:
      #   class MyMarkerThing
      #     include Bio::Map::ActsLikeMarker
--- 159,178 ----
        end
        
!     end # ActsLikeMap
  
!     # == Description
!     #
!     # The Bio::Map::ActsLikeMarker module contains methods that are
!     # typical for marker-like things:
!     #
      # * map it to one or more maps
      # * check if it's mapped to a given map
!     #   and can be mixed into other classes (e.g. Bio::Map::Marker)
      # 
!     # Classes that include this mixin should provide an array property
!     # called mappings_as_marker.
!     #
      # For example:
+     #
      #   class MyMarkerThing
      #     include Bio::Map::ActsLikeMarker
***************
*** 166,176 ****
      #     attr_accessor :name, :mappings_as_marker
      #    end
      module ActsLikeMarker
!       # = DESCRIPTION
        # Adds a Bio::Map::Mappings object to its array of mappings.
        # 
!       # = USAGE
        #   # suppose we have a Bio::Map::Marker object called marker_a
        #   marker_a.add_mapping_as_marker(Bio::Map::SimpleMap.new('my_map'), '5')
        # ---
        # *Arguments*:
--- 184,199 ----
      #     attr_accessor :name, :mappings_as_marker
      #    end
+     #
      module ActsLikeMarker
! 
!       # == Description
!       #
        # Adds a Bio::Map::Mappings object to its array of mappings.
        # 
!       # == Usage
!       #
        #   # suppose we have a Bio::Map::Marker object called marker_a
        #   marker_a.add_mapping_as_marker(Bio::Map::SimpleMap.new('my_map'), '5')
+       #
        # ---
        # *Arguments*:
***************
*** 242,252 ****
        
  
!     end #ActsLikeMarker
  	  
!     # = DESCRIPTION
      # Creates a new Bio::Map::Mapping object, which links Bio::Map::ActsAsMap-
      # and Bio::Map::ActsAsMarker-like objects. This class is typically not
      # accessed directly, but through map- or marker-like objects.
      class Mapping
        include Comparable
        
--- 265,277 ----
        
  
!     end # ActsLikeMarker
  	  
!     # == Description
!     #
      # Creates a new Bio::Map::Mapping object, which links Bio::Map::ActsAsMap-
      # and Bio::Map::ActsAsMarker-like objects. This class is typically not
      # accessed directly, but through map- or marker-like objects.
      class Mapping
+ 
        include Comparable
        
***************
*** 283,296 ****
      end # Mapping
      
!     # = DESCRIPTION
!     # This class handles the essential storage of name, type and units of a map.
!     # It includes Bio::Map::ActsLikeMap, and therefore supports the methods of
!     # that module.
      # 
!     # = USAGE
      #   my_map1 = Bio::Map::SimpleMap.new('RH_map_ABC (2006)', 'RH', 'cR')
      #   my_map1.add_marker(Bio::Map::Marker.new('marker_a', '17')
      #   my_map1.add_marker(Bio::Map::Marker.new('marker_b', '5')
      class SimpleMap
        include Bio::Map::ActsLikeMap
      
--- 308,325 ----
      end # Mapping
      
!     # == Description
!     #
!     # This class handles the essential storage of name, type and units
!     # of a map.  It includes Bio::Map::ActsLikeMap, and therefore
!     # supports the methods of that module.
      # 
!     # == Usage
!     #
      #   my_map1 = Bio::Map::SimpleMap.new('RH_map_ABC (2006)', 'RH', 'cR')
      #   my_map1.add_marker(Bio::Map::Marker.new('marker_a', '17')
      #   my_map1.add_marker(Bio::Map::Marker.new('marker_b', '5')
+     #
      class SimpleMap
+ 
        include Bio::Map::ActsLikeMap
      
***************
*** 324,336 ****
      end # SimpleMap
      
!     # = DESCRIPTION
!     # This class handles markers that are anchored to a Bio::Map::SimpleMap. It
!     # includes Bio::Map::ActsLikeMarker, and therefore supports the methods of
!     # that module.
      # 
!     # = USAGE
      #   marker_a = Bio::Map::Marker.new('marker_a')
      #   marker_b = Bio::Map::Marker.new('marker_b')
      class Marker
        include Bio::Map::ActsLikeMarker
        
--- 353,369 ----
      end # SimpleMap
      
!     # == Description
!     #
!     # This class handles markers that are anchored to a Bio::Map::SimpleMap.
!     # It includes Bio::Map::ActsLikeMarker, and therefore supports the
!     # methods of that module.
      # 
!     # == Usage
!     #
      #   marker_a = Bio::Map::Marker.new('marker_a')
      #   marker_b = Bio::Map::Marker.new('marker_b')
+     #
      class Marker
+ 
        include Bio::Map::ActsLikeMarker
        
***************
*** 352,355 ****
--- 385,390 ----
        
      end # Marker
+ 
    end # Map
+ 
  end # Bio



More information about the bioruby-cvs mailing list