[Biopython] Parsing DNA coordinate files in the pdb
Ahmad Abdelzaher
underoath006 at gmail.com
Thu May 4 11:42:13 UTC 2017
Amazing. But for atom in residue doesn't seem to be working! I also
want to to atom.get_coord(), any idea how?
On Thu, May 4, 2017 at 11:14 AM, Peter Cock <p.j.a.cock at googlemail.com> wrote:
> 1JO7 is an RNA structure, Solution Structure of Influenza A Virus Promoter.
>
> And yes, you can parse it with Biopython:
>
> $ python3
> Python 3.6.0 (v3.6.0:41df79263a11, Dec 22 2016, 17:23:13)
> [GCC 4.2.1 (Apple Inc. build 5666) (dot 3)] on darwin
> Type "help", "copyright", "credits" or "license" for more information.
>>>> from Bio.PDB import PDBParser
>>>> parser = PDBParser()
>>>> structure = parser.get_structure("1JO7", "1jo7.pdb")
>>>> len(structure)
> 32
>>>> model = structure[0]
>>>> for chain in model:
> ... for residue in chain:
> ... print(residue)
> ...
> <Residue A het= resseq=1 icode= >
> <Residue G het= resseq=2 icode= >
> <Residue U het= resseq=3 icode= >
> <Residue A het= resseq=4 icode= >
> <Residue G het= resseq=5 icode= >
> <Residue A het= resseq=6 icode= >
> <Residue A het= resseq=7 icode= >
> <Residue A het= resseq=8 icode= >
> <Residue C het= resseq=9 icode= >
> <Residue A het= resseq=10 icode= >
> <Residue A het= resseq=11 icode= >
> <Residue G het= resseq=12 icode= >
> <Residue G het= resseq=13 icode= >
> <Residue C het= resseq=14 icode= >
> <Residue U het= resseq=15 icode= >
> <Residue U het= resseq=16 icode= >
> <Residue C het= resseq=17 icode= >
> <Residue G het= resseq=18 icode= >
> <Residue G het= resseq=19 icode= >
> <Residue C het= resseq=20 icode= >
> <Residue C het= resseq=21 icode= >
> <Residue U het= resseq=22 icode= >
> <Residue G het= resseq=23 icode= >
> <Residue C het= resseq=24 icode= >
> <Residue U het= resseq=25 icode= >
> <Residue U het= resseq=26 icode= >
> <Residue U het= resseq=27 icode= >
> <Residue U het= resseq=28 icode= >
> <Residue G het= resseq=29 icode= >
> <Residue C het= resseq=30 icode= >
> <Residue U het= resseq=31 icode= >
>
>
> The 32 models here are the 32 conformers submitted, according
> to the website they are those with Lowest Energy and Acceptable
> Covalent Geometry.
>
> By co-incidence there are also 32 residues, RNA bases A, G, U,
> ..., G, C, U.
>
> This matches the FASTA sequence available from the PDB:
>
>>1JO7:A|PDBID|CHAIN|SEQUENCE
> AGUAGAAACAAGGCUUCGGCCUGCUUUUGCU
>
> Regards,
>
> Peter
>
> On Thu, May 4, 2017 at 4:40 AM, Ahmad Abdelzaher <underoath006 at gmail.com> wrote:
>> Is there a way in Biopython to parse .pdb files that contain the
>> crystal structure of molecules other than proteins, for example
>> 1jo7.pdb?
>>
>> Regards.
>> _______________________________________________
>> Biopython mailing list - Biopython at mailman.open-bio.org
>> http://mailman.open-bio.org/mailman/listinfo/biopython
More information about the Biopython
mailing list