[Biopython] Question about using Gapped Alignment in Bio.CAPS.CAPSMap (Differential Cutsites)

[Peter Cock]

Hello Ester,

The bad news is that Bio.CAPS was written back in 2005 by
Jonathan Taylor, and has only had maintenance changes
since then. The module does not have an active maintainer.

http://mailman.open-bio.org/pipermail/biopython-dev/2005-February/001916.html
https://github.com/biopython/biopython/commit/46c87158da786ade74e2c3dc5771ea7308eb0d5a

I don't think Jonathan has been active in Biopython for some
years, but I have CC'd his old email address just in case (we
would also like to ask him about dual licensing his code).

My impression from the Bio.CAPS code and tests is that it
does not expect any gaps, and that each sequence in the
alignment should be the same length (which is what the
more recent code in Bio.AlignIO expects too).

Internally Bio.CAPS used Bio.Restriction for the EcoRI and
AluI digest enzymes, and I think that does not care about
upper versus lower case.

Peter

On Tue, Aug 15, 2017 at 6:04 PM, RYU Esther (INTERN)
<Esther.RYU.intern at 3ds.com> wrote:
> Hi all,
>
>
>
> Two questions –
>
>
>
> ·         Can CAPSMap() take an alignment that has gaps?  I see errors both
> if the alignment has gap characters and if there are no gaps but the
> sequences are of different lengths.
>
>
>
> ·         What role does upper/lower case play in alignments?  BioPython
> test alignment sequences are gapless and mixed case.  Wondering what I’m
> missing here, especially regarding gaps.  A pointer to documentation would
> be great.
>
>
>
> Background –
>
>
>
> I am having some difficulty understanding/using the Bio.CAPS module. If I
> pass in an alignment with gap characters into CAPSMAP() and call
> ._digest_with() on it, I receive an invalid character error. When I remove
> the offending characters (‘-‘ and ‘.’), I receive an error from the
> AlignIO.read() method that the lengths of the sequences are not the same. I
> looked at the provided test file (test_CAPS.py), and noticed that the
> aligned sequences do not contain gap characters and that the sequences also
> contain lowercase letters. Is this module only workable if the alignment has
> no gap characters and has the same length? And what role does case play in
> these aligned sequences?
>
>
>
> Here is the script I ran:
>
>
>
> from Bio.CAPS import DifferentialCutsite
>
> from Bio.CAPS import CAPSMap
>
> from Bio import AlignIO
>
> from Bio.Restriction import *
>
> def main():
>
>       alignment = AlignIO.read("gap_chars.txt", "fasta")
>
>       map = CAPSMap(alignment)
>
>       enzymes = [EcoRI]
>
>       for enzyme in enzymes:
>
>             map._digest_with(enzyme)
>
> main()
>
>
>
> Here are the 2 data files I ran:
>
>
>
> Data file 1: “gap_chars.txt”
>
>
>
>>gi|2695850|emb|Y13260.1|ABY13260/1-573
>
> TCTGCTGGTTACAACACTTTCTTCTTTCAATAAC.CACAATACTGCAGTACAATGG.GGA
>
>>gi|2695854|emb|Y13264.1|ABY13264/1-547
>
> .................TTTCTTCTTTCAATAAC.CACAATACTGCAGTACAATGG.GGA
>
>
>
> Data file 2: “no_gaps.txt”
>
>
>
>>gi|2695850|emb|Y13260.1|ABY13260 Acipenser baeri mRNA for immunoglobulin
>> heavy chain, clone ScH 16.1
>
> TCTGCTGGTTACAACACTTTCTTCTTTCAATAACCACAATACTGCAGTACAATGGGGA
>
>>gi|2695854|emb|Y13264.1|ABY13264 Acipenser baeri mRNA for immunoglobulin
>> heavy chain, clone ScH 113
>
> TTTCTTCTTTCAATAACCACAATACTGCAGTACAATGGGGA
>
>
>
> If someone could better help me understand how to use this module I’d
> greatly appreciate it!
>
>
>
> Regards,
>
>
>
> Esther
>
>
>
> This email and any attachments are intended solely for the use of the
> individual or entity to whom it is addressed and may be confidential and/or
> privileged.
>
> If you are not one of the named recipients or have received this email in
> error,
>
> (i) you should not read, disclose, or copy it,
>
> (ii) please notify sender of your receipt by reply email and delete this
> email and all attachments,
>
> (iii) Dassault Systemes does not accept or assume any liability or
> responsibility for any use of or reliance on this email.
>
> For other languages, go to http://www.3ds.com/terms/email-disclaimer
>
>
> _______________________________________________
> Biopython mailing list  -  Biopython at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/biopython