[Biopython] blast against genomes in biopython

[halima saker]

from Bio import Entrez, SeqIO
from Bio.Blast import NCBIXML
from Bio.Blast import NCBIWWW
result_handle = NCBIWWW.qblast("blastn","nr", "CACTTATTTAGTTAGCTTGCAACCCTGGATTTTTGTTTACTGGAGAGGCC",entrez_query='"Beutenbergia cavernae DSM 12333" [Organism]')
blast_records = NCBIXML.parse(result_handle)
    for blast_record in blast_records:
        for alignment in blast_record.alignments:
           for hsp in alignment.hsps:
               print(hsp.query[0:75] + '...')
               print(hsp.match[0:75] + '...')
               print(hsp.sbjct[0:75] + '...')



this does not give me an output, although the sequence is actually a 
sequence of the genome, so i must get a result. where is the error? the 
query is correct? 		 	   		  
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.open-bio.org/pipermail/biopython/attachments/20140711/5f10f3d2/attachment.html>