[Biopython] consensus for forward and reverse reads from a sequencing run

[Leo Alexander Hansmann]

Hi,
I'm getting two fasta files from an Illumina MiSeq run. One contains forward, the other reverse reads. The lines in both files are corresponding, meaning the first sequence in the forward read file should pair with the first sequence line in the reverse read file. Both sequences overlap in the middle in a varying amount of nucleotides. How can I get python or biopython to generate a file with the consensus sequences of each read. For example:
sequence in the forward read file: AATCGTCGGTTACTCTG
corresponding line in the reverse read file: CTCTGAGGGAGAGATC
I want: AATCGTCGGTTACTCTGAGGGAGAGATC
Thank you so much!
Leo