[Biopython] How to do RNA-RNA hybridization searches?

[Eric Ma]

I might try Ivan's approach. I was also trying to accommodate non-fully complementary portions. My bad for not stating this. 




Thanks everybody!

Cheers,
Eric

Sent from a mobile device. Please pardon typo errors.

On Thu, Oct 10, 2013 at 3:59 PM, Chris Mitchell <chris.mit7 at gmail.com>
wrote:

> If you want to do it in python, it's fairly trivial.
> a = 'CGACGUAUGUUAUGAGCUGAUGGUCACGUGUCGAUGGCUAUAG'
> for i in xrange(0,len(a)-14):
>     if a[i:i+15] in seq2:
>         do this
> or is there some reason you aren't taking this approach?
> On Thu, Oct 10, 2013 at 3:33 PM, Eric Ma <ericmajinglong at gmail.com> wrote:
>> Hi everybody,
>>
>> I'm looking to try my hand at doing the following problem:
>>
>> I have a sequence of RNA, say, "RNA SEQUENCE 1":
>> "...CGACGUAUGUUAUGAGCUGAUGGUCACGUGUCGAUGGCUAUAG..."
>>
>> I have another sequence of RNA, say "RNA SEQUENCE 2".
>>
>> I'd like to do 15-mer sliding window searches from RNA Sequence 1 (it'll
>> take a long time, I'm sure, but nonetheless that's what I'd like to do),
>> such that I search:
>>
>> "[*CGACGUAUGUUAUGA*]GCUGAUGGUCACGUGUCGAUGGCUAUAG"
>> "C[*GACGUAUGUUAUGAG*]CUGAUGGUCACGUGUCGAUGGCUAUAG"
>> "CG[*ACGUAUGUUAUGAGC*]UGAUGGUCACGUGUCGAUGGCUAUAG" etc. etc.
>>
>> along RNA Sequence 2, to see if I can find that same region present.
>>
>> I was wondering if there was some package that could do that, that either
>> BioPython interfaces with, or is separately implemented as a Python
>> package. Does anybody know if there is such a thing?
>>
>> Cheers,
>> Eric
>> -----------------------------------------------------------------------
>> Please consider the environment before printing this e-mail. Do you really
>> need to print it?
>>
>> http://about.me/ericmjl
>> _______________________________________________
>> Biopython mailing list  -  Biopython at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/biopython
>>