[Biopython] extending Motif class
Brad Chapman
chapmanb at 50mail.com
Fri Apr 1 00:59:52 UTC 2011
Philip;
> I want to add a new scoring function to the Motif class and in true
> object-oriented spirit would like to do it by deriving a new class rather
> than hacking the existing code.
The approach you want to take here is to define a function
that takes a motif as an input:
def pwm_score_hit(motif, sequence, position):
instead of trying to inherit from Motif. What happens in
your example is that you inherit from the Motif class:
> from Bio.Motif import Motif
>
> class ScannableMotif(Motif):
> def pwm_score_hit(self,sequence,position):
> ## stuff to compute my new score
Then you call ScannableMotif as if it were the Motif namespace, when
it is actually a class. The parse function is defined in Bio.Motif
not the Motif class:
> from Bio import Motif
> def main ():
> for motif in
> ScannableMotif.parse(open("/Users/philip/tmp/meme.txt"),"MEME"):
> for i in range(3):
> print
> motif.pwm_score_hit("CCTGGGGTCCCATTTCTCTTTTCTCTCCTGGGGTCCC",i)
Which is why you get an error. Your promotion trick does work but
really is too tricky and you are better off with just a separate
function that works on motif objects.
Hope this helps,
Brad
More information about the Biopython
mailing list