[Biopython] alignment/matching algorithm whichs allows missmatches at certain positions

[Peter]

On Tue, Sep 29, 2009 at 2:22 PM, Brad Chapman <chapmanb at 50mail.com> wrote:
> Hi Stefanie;
>
>> Does someone knows an algorithm to search for sequence similarity
>> by allowing missmatches at certain positions?
>>
>> E.g.
>> Looking in a sequence database for
>>
>> ATGCTCGCGCTCGCTCGCGCA
>>
>> by allowing an missmatch at position [3] and [18].
>
> dreg and fuzznuc in EMBOSS both do this:
>
> http://emboss.sourceforge.net/apps/release/6.1/emboss/apps/dreg.html
> http://emboss.sourceforge.net/apps/release/6.1/emboss/apps/fuzznuc.html

I didn't know about EMBOSS dreg - that looks rather neat.
We should add wrappers for these to Bio.Emboss.Applications ...

> The SHRiMP aligner also allows you to specify a seed with defined
> match and mismatch positions:
>
> http://compbio.cs.toronto.edu/shrimp/
>
> See the '-s' option in the README.

That's a neat trick.

Peter