[BioPython] Sequence from Fasta

[Peter]

On Mon, Jun 30, 2008 at 10:40 AM, Giovanni Marco Dall'Olio
<dalloliogm at gmail.com> wrote:
> On Sun, Jun 29, 2008 at 4:42 PM, Stefanie Lück <lueck at ipk-gatersleben.de> wrote:
>
>> If I try the code from page 10 in the tutorial, I get of course this:
>
> Seq('CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAA
> ...', SingleLetterAlphabet())
>
> Try with seq_record.seq.data.

I would like to discourage using the Seq object's .data property if
possible, in favour of my_seq.tostring() which will work even on very
old versions of Biopython, or str(my_seq) if you are up to date.

I've mooted deprecating the Seq object's .data property as part of
making the Seq object more string like (Bug 2509 and Bug 2351).

http://bugzilla.open-bio.org/show_bug.cgi?id=2509
http://bugzilla.open-bio.org/show_bug.cgi?id=2351

User feedback would be good, but to explain my current thinking: I'm
hoping to reduce the Seq's .data to a read only property in a future
release, and then in a later release start issuing a deprecation
warning, before its eventual removal (Bug 2509).  At some point in
this process the Seq object would hopefully subclass the python string
(Bug 2351).

Peter