[BioPython] Sequence from Fasta

[Peter]

On Sun, Jun 29, 2008 at 3:42 PM, Stefanie Lück <lueck at ipk-gatersleben.de> wrote:
> Hi!
>
> Is there a way to extract only the sequence (full length) from a fasta file?

Yes.  Based on your requirement to have name-space-sequence, how about:

handle = open(filename)
from Bio import SeqIO
for record in SeqIO.parse(handle, "fasta") :
    print "%s %s" % (record.id, record.seq)
handle.close()

> If I try the code from page 10 in the tutorial, I get of course this:
> Seq('CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAA ...', SingleLetterAlphabet())

Which bit of the tutorial exactly?  That looks like printing the
repr() of a Seq object, and Seq objects don't have names.  If
something could be clarified that's useful feedback.

Peter