[BioPython] blast

[Peter Cock]

>> I need to know at which % my primer match to the query part:
>>
>>
>> query          --------taggcctcgcgcgcc-------
>>              ||||||||||||||||||||||||||||||
>> primer         tagcgctataggcctcgcgcgccatatagc
>>
>> Here 50 %.

How did you get this example?  NCBI Blast doesn't include the leading
and trailing gaps (in plain text, XML or HTML), e.g.

 Features in this part of subject sequence:
   transcription elongation factor protein, GreA/GreB family

 Score = 30.2 bits (15),  Expect =    39
 Identities = 15/15 (100%), Gaps = 0/15 (0%)
 Strand=Plus/Plus

Query  1        TAGGCCTCGCGCGCC  15
                |||||||||||||||
Sbjct  2614347  TAGGCCTCGCGCGCC  2614361


Peter