[BioPython] Rethinking Seq objects

[Michiel Jan Laurens de Hoon]

bneron at pasteur.fr wrote:
> just an exemple:
> 
> Python 2.3.4 (#1, Mar 11 2005, 17:34:27) 
> [GCC 3.3.5  (Gentoo Linux 3.3.5-r1, ssp-3.3.2-3, pie-8.7.7.1)] on linux2
> Type "help", "copyright", "credits" or "license" for more information.
> 
>>>>from Bio.Seq import Seq
>>>>from Bio import Translate
>>>>from Bio.Alphabet import IUPAC
>>>>my_alpha = IUPAC.unambiguous_dna
>>>>my_seq_upper = Seq('GATCGATGGGCCTATTAGGATCGAAAATCGC', my_alpha)
>>>>my_seq_lower = Seq('gatcgatgggcctattaggatcgaaaatcgc', my_alpha)
>>>>standard_translator = Translate.unambiguous_dna_by_id[1]
>>>>standard_translator.translate(my_seq_upper)
> 
> Seq('DRWAY*DRKS', HasStopCodon(IUPACProtein(), '*'))
> 
>>>>standard_translator.translate(my_seq_lower)
> 
> Seq('**********', HasStopCodon(IUPACProtein(), '*'))
> 
> 
> obviously the lower case doesn't work in the Seq object.

I agree, this should be corrected. The translate and transcribe methods should 
work with both uppercase and lowercase.

--Michiel.

-- 
Michiel de Hoon, Assistant Professor
University of Tokyo, Institute of Medical Science
Human Genome Center
4-6-1 Shirokane-dai, Minato-ku
Tokyo 108-8639
Japan
http://bonsai.ims.u-tokyo.ac.jp/~mdehoon