[BioPython] Re: [Biopython-dev] [Fwd: Question to code]

Thu Feb 17 12:36:14 EST 2005

Eirik,

Yes, you got that because you are probably using the 1.30 release 
version, which does not include qblast. Normally I would recommend 
checking out a new version form CVS. But these days the CVS is in 
constant flux because we're racing to make the release deadline. Best 
wait until Friday. (Saturday in Norway).

In most other cases, you can downlaod a tarball from:

http://cvs.biopython.org/cgi-bin/viewcvs/viewcvs.cgi/biopython/biopython.tar.gz?tarball=1&cvsroot=biopython

This you can open with winzip, but I am not sure about how to go about 
installation from source in Windows.

Thank you for your patience. And for drawing our attention to that bug.

Best,

Iddo

Eirik Sønneland wrote:

> Iddo!
>
> Not to familiar with use of CVS...is there an easy why to do this in 
> windows? I tried your new code and got:
>
> Traceback (most recent call last):
>   File "C:\Python24\MyWorkspace.py", line 23, in -toplevel-
>     b_results = NCBIWWW.qblast('blastn', 'nr', f_record).read()
> AttributeError: 'module' object has no attribute 'qblast'
>
> Yes I can wait to Friday, but since I'm using biopython in my master 
> it might be good to use CVS to always have the latest version??
>
> Thanks,
> Eirik
>
> Iddo Friedberg wrote:
>
>>
>> OK, I fixed that.
>>
>> Eirik, you can check out a copy fom CVS, or wait for the Friday release.
>>
>>
>>
>> ./I
>>
>>
>> Frank Kauff wrote:
>>
>>> Eirik,
>>>
>>> Try if the code works with
>>>
>>> b_results = NCBIWWW.qblast('blastn', 'nr', f_record).read()
>>>
>>> instead of
>>>  
>>>
>>>> b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
>>>>
>>>>   
>>>
>>>
>>> I think that issue appeared a couple of months ago on the biopython 
>>> list, essentially saying that
>>> qblast is the blast NCBI wants people to use for blast scripts? 
>>> After that, qblast method was added
>>> to NCBIWWW, and it's what I'm using in my blast scripts.
>>>
>>> Hope this helps,
>>> Frank
>>>
>>> On Wed, 2005-02-16 at 14:02 -0800, Iddo Friedberg wrote:
>>>  
>>>
>>>> OK, this is a real bug. NCBIWWW seems to be broken.
>>>>
>>>> I'm having a looksee, but I'd like someone more versed in this than 
>>>> me to do so.
>>>>
>>>> Thanks,
>>>>
>>>> Iddo
>>>>
>>>>
>>>>
>>>> -------- Original Message --------
>>>> Subject:     Question to code
>>>> Date:     Wed, 16 Feb 2005 15:19:57 +0100
>>>> From:     Eirik Sønneland <eirik.sonneland at student.umb.no>
>>>> To:     idoerg
>>>>
>>>>
>>>>
>>>> Dear Freidberg,
>>>>
>>>> I've been having problems parsing my output from NCBI using the 
>>>> example code given in Biopython Cookbook. Therefore I tried to 
>>>> follow your code described in "Genome Informatics 14(2003). Still I 
>>>> get an error message connected to the parsing. Could you please 
>>>> give a hint on what is wrong? Is this a bug?? Code and output as 
>>>> follows:
>>>>
>>>> Code:
>>>>
>>>> from Bio.Blast import NCBIWWW
>>>> from Bio import Fasta
>>>>
>>>> file_for_blast = open('Fastaformat.txt', 'r')
>>>> f_iterator = Fasta.Iterator(file_for_blast)
>>>> f_record = f_iterator.next()
>>>>
>>>> b_results = NCBIWWW.blast('blastn', 'nr', f_record).read()
>>>>
>>>> b_record = NCBIWWW.BlastParser().parse_str(b_results)
>>>>
>>>> Output(Have cut out the beginning, only pasted the last part of 
>>>> output):
>>>>
>>>>
>>>> Score = 40.1 bits (20), Expect = 6.3
>>>> Identities = 20/20 (100%)
>>>> Strand = Plus / Minus
>>>>
>>>>                                 Query: 29     ctgcagctcgggctcctgcc 48
>>>>              ||||||||||||||||||||
>>>> Sbjct: 150928 ctgcagctcgggctcctgcc 150909
>>>> </PRE>
>>>>
>>>>
>>>> <form>
>>>>
>>>> <PRE>
>>>> Lambda     K      H
>>>>    1.37    0.711     1.31
>>>>
>>>> Gapped
>>>> Lambda     K      H
>>>>    1.37    0.711     1.31
>>>>
>>>> Matrix: blastn matrix:1 -3
>>>> Gap Penalties: Existence: 5, Extension: 2
>>>> Number of Sequences: 2894376
>>>> Number of Hits to DB: 6,089,259
>>>> Number of extensions: 328661
>>>> Number of successful extensions: 6259
>>>> Number of sequences better than 10.0: 2
>>>> Number of HSP's better than 10.0 without gapping: 2
>>>> Number of HSP's gapped: 6259
>>>> Number of HSP's successfully gapped: 2
>>>> Number of extra gapped extensions for HSPs above 10.0: 6255
>>>> Length of query: 600
>>>> Length of database: 13,294,103,689
>>>> Length adjustment: 22
>>>> Effective length of query: 578
>>>> Effective length of database: 13,230,427,417
>>>> Effective search space: 7647187047026
>>>> Effective search space used: 7647187047026
>>>> A: 0
>>>> X1: 11 (21.8 bits)
>>>> X2: 15 (30.0 bits)
>>>> X3: 25 (50.0 bits)
>>>> S1: 14 (25.0 bits)
>>>> S2: 20 (40.1 bits)
>>>>
>>>>
>>>> </form>
>>>>
>>>> Traceback (most recent call last):
>>>>  File "C:\Python24\MyWorkspace.py", line 50, in -toplevel-
>>>>    b_record = NCBIWWW.BlastParser().parse_str(b_results)
>>>>  File "C:\Python24\Lib\site-packages\Bio\ParserSupport.py", line 
>>>> 52, in parse_str
>>>>    return self.parse(File.StringHandle(string))
>>>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 
>>>> 47, in parse
>>>>    self._scanner.feed(handle, self._consumer)
>>>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 
>>>> 99, in feed
>>>>    self._scan_rounds(uhandle, consumer)
>>>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 
>>>> 242, in _scan_rounds
>>>>    self._scan_alignments(uhandle, consumer)
>>>>  File "C:\Python24\Lib\site-packages\Bio\Blast\NCBIWWW.py", line 
>>>> 322, in _scan_alignments
>>>>    raise SyntaxError, "Cannot resolve location at line:\n%s" % line1
>>>> SyntaxError: Cannot resolve location at line:
>>>> </form>
>>>>
>>>> >>>
>>>>
>>>> Thanks!
>>>>
>>>> Regards,
>>>> Eirik
>>>>
>>>>
>>>>   
>>>
>>
>>
>

-- 
Iddo Friedberg, Ph.D.
The Burnham Institute
10901 N. Torrey Pines Rd.
La Jolla, CA 92037 USA
Tel: +1 (858) 646 3100 x3516
Fax: +1 (858) 713 9930
http://ffas.ljcrf.edu/~iddo
==========================
The First Automated Protein Function Prediction SIG
Detroit, MI June 24, 2005
http://ffas.burnham.org/AFP